Skip to main content

Table 2 Primer sequences for quantitative real-time PCR validation.

From: Pro-neural transcription factors as cancer markers

Gene Primer sense Primer antisense
SDH TGGGAACAAGAGGGCATCTG CCACCACTGCATCAAATTCATG
GAPDH GCAAATTCCATGGCACCGT TCGCCCCACTTGATTTTGG
UBC ATTTGGGTCGCGGTTCTTG TGCCTTGACATTCTCGATGGT
TBP GAATATAATCCCAAGCGGTTTG ACTTCACATCACAGCTCCCC
Neuromedin/NT GAGGAGCTTGTTGCAAGAAGGA GCCCTGCTGTGACAGATTTTGT
Hes6 AGCTCCTGAACCATCTGCTC GACTCAGTTCAGCCTCAGGG
Ascl1 GAGCAGGAGCTTCTCGACTTC GATGCAGGTTGTGCGATCAC
Hes1 TGGAAATGACAGTGAAGCACCT GTTCATGCACTCGCTGAAGC
NeuroD1 CGCTGGAGCCCTTCTTTG GCGGACGGTTCGTGTTTG
DDC AAGCACAGCCATCAGGATTCA TGGACATGCTTGCGGATATAAG
Neurogenin 2 CGCATCAAGAAGACCCGTAG GTGAGTGCCCAGATGTAGTTGTG
  1. Primers for quantitative real time polymerase chain reaction using Sybrgreen chemistry were designed using Primer Express software (Applied Biosystems)