Skip to main content

Table 1 Primers for real time PCR, amplicon size, values of slope, PCR efficiency and linearity (R2).

From: Searching for molecular markers in head and neck squamous cell carcinomas (HNSCC) by statistical and bioinformatic analysis of larynx-derived SAGE libraries

Genes Primers 5' → 3' Amplicon size (bp) Slope PCR Efficiency R2
GNA15 Forward GAGAACCGCATGAAGGAGAG 84 -3.312 100.0 0.991
  Reverse AAAGAGGATGACGGATGTGC     
KRT31 Forward TGAGCAGGAGGTCAATACCC 110 -2.913 120.4 0.990
  Reverse GACTCCTGGTCTCGTTCAGC     
BST2 Forward GGAGGAGCTTGAGGGAGAG 75 -3.476 93.9 0.991
  Reverse CTCAGTCGCTCCACCTCTG     
MFAP2 Forward GCCGTGAGGAACAGTACCC 91 -3.152 107.6 0.990
  Reverse CGGAGGCTGTAGAAGCAGAC     
TUBA6 Forward TCAACACCTTCTTCAGTGAAACG 101 -3.341 99.2 0.991
  Reverse AGTGCCAGTGCGAACTTCATC     
GAPDH Forward ACCCACTCCTCCACCTTTGA 101 -3.392 97.1 0.990
  Reverse CTGTTGCTGTAGCCAAATTCGT     
ACTB Forward GGCACCCAGCACAATGAAG 66 -3.255 102.8 0.994
  Reverse CCGATCCACACGGAGTACTTG