Skip to main content

Advertisement

Table 2 Genes containing multiple probes that are affected by SNPs that also affect other probes in the same gene, but with opposite allelic directions

From: Complex nature of SNP genotype effects on gene expression in primary human leucocytes

Source SNP HUGO Spearman Probe Unique Illumina Identifier* Probe Sequence Number of dbSNP polymorphisms known within probe region
Celiac rs1131383 POLR2J -0.48 GI_62422568 ILMN_1657317   0
HapMap rs1131383 POLR2J 0.57 GI_21704275 4210731   0
Celiac rs1901198 IRF5 -0.6 GI_38683857 ILMN_1670576   0
HapMap rs1901198 IRF5 0.5 GI_38683858 1770358   0
Celiac rs6565724 LOC400566 0.67 GI_62177143 ILMN_1713803   0
HapMap rs6565724 LOC400566 -0.72 GI_37544593 6040008   0
HapMap rs6565724 LOC400566 -0.74 GI_42661283 103170403   0
Celiac rs2863095 MRPL43 0.45 GI_28872731 ILMN_1652147   0
Celiac rs2863095 MRPL43 -0.49 GI_28872733 ILMN_1700477   0
HapMap rs2863095 MRPL43 0.58 GI_28872731 3940465   0
HapMap rs2863095 MRPL43 -0.61 GI_28872733 5900487   0
HapMap rs4768933 DIP2B 0.42 GI_17457388 101780735   0
HapMap rs4768933 DIP2B -0.44 GI_39930390 3940278   0
Celiac rs10774679 OAS1 -0.54 GI_74229010 ILMN_1658247   0
Celiac rs10774679 OAS1 0.51 GI_74229012 ILMN_1672606   0
HapMap rs3177979 OAS1 0.63 GI_8051620 2100154   0
HapMap rs3177979 OAS1 -0.72 GI_8051622 2100048   0
Celiac rs1040404 TIPRL -0.47 GI_73088904 ILMN_1779432   0
Celiac rs1040404 TIPRL 0.5 GI_73088933 ILMN_1781457   0
HapMap rs222851 C17orf81 -0.72 GI_44662825 6380129   0
HapMap rs222851 C17orf81 0.64 GI_44662829 2760301   0
Celiac rs34374 PAM 0.43 GI_21070979 ILMN_1788631 GGCTACAGTCGAAAAGGGTTTGACCGGCTTAGCACTGAGGGCAGTGACCA 0
HapMap rs34374 PAM -0.41 GI_21070979 60056 GCCAGTGTCTTTCTTTGGTGCCTTTCCTGTTCAGCATTCTTAGCCTGTGG 0
HapMap rs2838859 POFUT2 -0.48 GI_34147486 5900341   1
HapMap rs2838859 POFUT2 0.45 Hs.300736 106110059   0
Celiac rs7084722 PTER -0.43 GI_47933342 ILMN_1795336   0
HapMap rs7084722 PTER 0.48 GI_20070185 5570040   1
Celiac rs10503170 MYOM2 0.43 GI_4505314 ILMN_1716733 ATTTTCACGGGTGTGGGCACATGGGTGTGGCACCTGGACGTGTGCAGCAT 1
HapMap rs10503170 MYOM2 -0.42 GI_4505314 6620154 TTTACACGAGGGTAGACGGCAGATGCCTGACAGAGAGTGGGTTGGCAGAC 1
Celiac rs11680305 ADI1 -0.42 GI_8922761 ILMN_1795671 CCGGTGGTGTGATGATGCCATATACCGCAGGGCTTGCTTCTGTCAAGTGT 1
HapMap rs11680305 ADI1 0.41 GI_8922761 4730070 GAGCTCCCACCCTAAGGGGCACACACTGAGTTGCTTATGCCACTTCCTTG 0
Celiac rs2395185 HLA-DRB5 -0.41 GI_26665892 ILMN_1697499 GGCTCTTATTCTTCCACAAGAGAGGACTTTCTCAGGCCCTGGTTGCTACC 3
HapMap rs2395185 HLA-DRB5 0.47 GI_26665892 450332 ACGGCCTCCCATGCATCTGTACTCCCCCTGTGTGCCACAAATGCACTACG 8
  1. Meta-analysis of different significant but opposite allelic effects of SNPs (FDR = 0.05, SNP-probe midpoint distance < 250 kb) in the celiac peripheral blood dataset and HapMap B cell line data set. Shown are 14 genes that contain probes for either of the two platforms but that show opposite allelic directions. If probes have identical identifiers on the two platforms, but different oligonucleotide sequences, the oligonucleotide sequences are indicated.
  2. *As provided by Illumina platform record.