Skip to main content

Table 2 Novel miRNAs and miRNA candidates.

From: Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing

Locus ID Coordinates Sequence Status
12783 chr13:23634608–23634629(+) TCTGCAAGTGTCAGAGGCGAGG miRNA
19011 chr16:3870478–3870503(-) GGCGGCGGCGGCGGCGGAACGG miRNA
41039 chr5:92982172–92982192(-) TGACAGCGCCCTGCCTGGCTC miRNA
49828 chr9:96612080–96612101(+) GAGAGCAGTGTGTGTTGCCTGG miRNA
53356 chrX:151975564–151975586(-) CGGCGGCGGCGGCGGCGGACGGG miRNA
52195 chrX:49662029–49662050(+) TAATCCTTGCTACCTGGGTGAG alt
37600 chr4:17057782–17057802(-) TCGAGGAGCTCACAGTCTAGT alt
6219 chr10:97814116–97814137(-) TTCAGCCAGGCTAGTGCAGTCT cand
19702 chr17:59060613–59060634(+) ACTGGCTTGTGGCAGCCAAGTG cand
21361 chr17:15095708–15095729(-) TGCTGGGGGCCACATGAGTGTG cand
23602 chr19:764627–764645(+) TTGGCCATGGGGCTGCGCG cand
25697 chr2:11825070–11825091(+) TAATGGCCAAAACTGCAGTTAT cand
32226 chr22:49459945–49459967(+) CCCGGGGCCAGCGCCGTGGTCGT cand
52275 chrX:128945787–128945807(+) CGGCGGGCGGCGGGGCGGGGC cand
  1. Columns show the locus ID, genome coordinates, sequence, and miRNA status: miRNA (submitted to miRBase), alt (candidate alternative precursor for known miRNA), or cand (candidate miRNA). The most highly expressed read for a locus is shown. Only loci that have not been included in miRBase yet are shown.