Skip to main content

Table 1 Primers used for quantitative PCR

From: Novel transcriptional profile in wrist muscles from cerebral palsy patients

Gene Transcript Base pairs Sense Primer (5'-3') Antisense Primer (5'-3')
COL1A2 NM_000089 225 TCCAAAGGAGAGAGCGGTAA GCCACTTGCACCACGACTA
COL4A2 NM_001846 269 CTGGGTGGCGGAGTTTGTG GCTGATGTGTGTGCGGATGAG
COL4A3 NM_000091 157 CACCAGCTCTGATGCCAATG AGAGAAATCCAGCCGTGAGG
DMD NM_004019 151 GACCAGCACAACCTCAAGCAA TCAGCAGCCAGTTCAGACACA
FBXO32 NM_058229 376 GTCCAAAGAGTCGGCAAGT TTGGGTAACATCGGACAAGT
GAPDH NM_002046 172 TCTGACTTCAACAGCGACAC TGGTCCAGGGGTCTTACTC
IGF1 NM_000618 355 AGCAGTCTTCCAACCCAATTA CACGGACAGAGCGAGCTG
IGFBP5 NM_000599 339 CCAAACACACCCGCATCT CAGCTTCATCCCGTACTTGTC
GDF8 NM_005259 167 TATCACGCTACAACGGAAAC GGAGTCTCGACGGGTCTC
MYH1 NM_005963 132 AAGAGCAGGGAGGTTCACAC TTATCTCCAAAAGTCATAAGTACA
NEB NM_004543 131 CCGTGCCATGTATGACTATAT CGGTCCTGCCAGTCCTCTG
PVALB NM_002854 329 GATGACAGACTTGCTGAACGC CTTAGCTTTCAGCCACCAGAG
TRIM63 NM_032588 393 GAGGATTCCCGTCGAGTGAC AATGGCTCTCAGGGCGTCT
  1. Table of primers used for QPCR analysis. Genbank accession number and PCR product length given in parentheses after each transcript name