Skip to main content

Table 1 Sequences of primers used in RT-PCR

From: Gene expression profile analysis of human hepatocellular carcinoma using SAGE and LongSAGE

Unigene GenBank
Accession No.
Product
Size
Primers
GAPDH NM_002046 106 bp F:ATGGGTGTGAACCATGAGAAG
R:AGTTGTCATGGATGACCTTGG
CCL20 BC020698 200 bp F:GCGCAAATCCAAAACAGACT
R:CAAGTCCAGTGAGGCACAAA
S100P BC006819 116 bp F:TACCAGGCTTCCTGCAGAGT
R:AGCCACGAACACGATGAACT
PEG10 NM_015068 111 bp F:TCCTGTCTTCGCAGAGGAGT
R:TTCACTTCTGTGGGGATGGA
SGCE NM_003919 220 bp F:ATGCAAACACCAGACATCCA
R:TCTGATGTGGCAAGTTCTGC
XAGE-1 AF251237 159 bp F:TCTGCAAGAGCTGCATCAGT
R:AGCTTGCGTTGTTTCAGCTT
COL4A1 NM_001845 228 bp F:ACGGGGGAAAACATAAGACC
R:TGGCGCACTTCTAAACTCCT
ZFYVE1 NM_178441 213 bp F:AACTGCTACGAAGCCAGGAA
R:GTTGTGGCAGTGGAGGATTT
ZNF83 BC050407 224 bp F:TGGGAAGGTCTTCGGTCTAA
R:CGGCATGAAATCTCTGATGA
TNPO2 NM_013433 213 bp F:GGCGTTGTGCAGGACTTTAT
R:GGCAGTCTCCATGATCACCT
TM4SF1 NM_014220 169 bp F:AGGGCCAGTACCTTCTGGAT
R:AAGCCACATATGCCTCCAAG