Skip to main content

Table 5 The primers designed for end point PCR analysis of DYZ1 repeat region.

From: Genetic integrity of the human Y chromosome exposed to groundwater arsenic

Primer Sequence Location Orientation Tm(°C)
DYZ1A TTTCCTTTCGCTTGCATTCCAT 25-47 5'-3' 65
DYZ1B TTTTGAGTCCGTTCCATAACAC 1347-1367 5'-3' 64
DYZ1C GAGTCCATTCACTTCCAGAACA 3128-3149 5'-3' 63
DYZ1D CCATGCCATTTTATTGCGTTGC 1791-1821 5'-3' 63
DYZ1E GACTGGAAAGGCTGGGTGTCGA 3380-3402 3'-5' 63
DYZ1F TGAAATGGACTGGAAAGGAATG 268-290 3'-5' 64
DYZ1G TGGAATGGACTGCAATAGAAAG 1566-1588 3'-5' 64
DYZ1H TGGAATGGACTCGAACAGAGTG 2097-2119 3'-5' 64