Skip to main content

Table 1 PCR Primers used for semi-quantitative real time PCR validation.

From: Impact of RNA degradation on gene expression profiling

Systematic Name Gene Name Primer Sequence (5'→3')
NM_005185.2 CALML3 Fwd: AGGCCTTCTCCCTGTTTGAC
   Rev: CCGGTCGATCTCACTCATC
NM_018403.4 DCP1A Fwd: AGCATCACCAGCAGATCCTT
   Rev: TATTCCACAGCCTTGCTCCT
NM_145301.2 FAM18B2 Fwd: AAGAGCCATTGGGTGTTTGA
   Rev: AGGCAATAAGTCCCAACCAA
NM_005336.3 HDLBP Fwd: CAGGACCTGCTCCACTGTTT
   Rev: AGGCCAGAGTGCTGACTGAC
XR_038543.2 LOC644604 Fwd: TGCCTGGGTCTTGGATAAAC
   Rev: GGGCATCAACGATAGTCACA
NM_018222.3 PARVA Fwd: TTTGAGCTCATGCAAGATGG
   Rev: CGGTACTTGGTGAAGAGGTTG
NM_001135771.1 RPN2 Fwd: GCTTCTGCTCTTCGCTCTGT
   Rev: CCAGCATAGCAGCATGTCC
NM_003133.5 SRP9 Fwd: CAGACCTGGGAGGAGTTCAG
   Rev: CACAAGTTCCCATCAGAATGC
NM_006082.2 TUBA1B Fwd: ACGTGGTTCCCAAAGATGTC
   Rev: CACAGTGGGAGGCTGGTAGT
NM_002046.3 GAPDH Fwd: CCACATCGCTCAGACACCAT
   Rev: CCAGGCGCCCAATACG
NM_000194.1 HPRT1 Fwd: TGACACTGGCAAAACAATGCA
   Rev: GGTCCTTTTCACCAGCAAGCT
NM_003406.2 YWHAZ Fwd: ACTTTTGGTACATTGTGGCTTCAA
   Rev: CCGCCAGGACAAACCAGTAT