Skip to main content

Table 1 Primer sequences of the diagnostic genes

From: Conversion of a molecular classifier obtained by gene expression profiling into a classifier based on real-time PCR: a prognosis predictor for gliomas

Gene Symbol Forward Reverse
IGFBP2 GCACATCCCCAACTGTGACA TTCAGAGACATCTTGCACTGTTTG
VMP1 TGTCTTCTGTTGGGCTTGGAA TGAGGCTATATGTGGACCCAGATA
MSN GCCCCGGACTTCGTCTTC AGGCCAAGATCCGCTTGTTA
TIMP1 CACAGACGGCCTTCTGCAAT TGGTGTCCCCACGAACTTG
LGALS1 CTCCTGACGCTAAGAGCTTCGT GAAGTGCAGGCACAGGTTGTT
CD63 CCCGAAAAACAACCACACTGC GATGAGGAGGCTGAGGAGACC
NES CAACAGCGACGGAGGTCTC CCTCTACGCTCTCTTCTTTGAGT
CLIC1 TGTTCATGGTACTGTGGCTCAAG GTCCGCCTTTTGGTGTCAAC
TNC ACCACAATGGCAGATCCTTC GCCTGCCTTCAAGATTTCTG
TAGLN2 CCTCTGGGAAGGAAAGAACATG AGCCCACCCAGATTCATCAG
HES6 GACCAATGCCAGCCAGAG GCAAGCCATCCATCAGAGG
VEGF CCAAGGCCAGCACATAGGA TCTTTGGTCTGCATTCACATTTG
VIM TCCAAACTTTTCCTCCCTGAAC GGGTATCAACCAGAGGGAGTGA
LDHA CTGGGAGTTCACCCATTAAGCT CAGGCACACTGGAATCTCCAT
RPIP8 CCCCCGTGGTCATCGA GGTAGTCGTAGCTCTGCGTGAA
IFITM3 GGCTTCATAGCATTCGCCTACT TCACGTCGCCAACCATCTT
PPIB GGAGAGAAAGGATTTGGCTACAAA CCTGGATCATGAAGTCCTTGATT
ALDOC CGTCCGAACCATCCAGGAT CCACACCCTTGTCAACCTTGAT
ZYX CAGCAGCTAATGCAGGACATG CAGAGTTCGTTGACAGCCACAT
UPAR GTGTGTGGGTTAGACTTGTGCAA AGGTAACGGCTTCGGGAATAG
LAMB2 CCACTGAAGGCGAGGTCATC CCCGTAGGTTGGTGATCTTCAA
RTN1 CCGCATCTACAAGTCTGTTTTACAA AAGCTCCAAGTAGGCCTTGAAAG
HMOX1 GGCAGAGAATGCTGAGTTCATG AGGCCATCACCAGCTTGAAG
GM2A GTCCCCCTGAGTTCTCCTCT GCTCTTGGGCAGTGAGTAGG
S100A10 TGGAAAAGGAGTTCCCTGGAT TACACTGGTCCAGGTCCTTCATT
BRSK2 GGAGGAGATGTCCAACCTGACA AAGTTCCCAAACCAGGACTTCTT
MRCL3 AACAGAGATGGTTTCATCGACAAG GTTGGATTCTTCCCCAATGAAG
GPX1 GCGGGGCAAGGTACTACTTA CTCTTCGTTCTTGGCGTTCT
SOD2 AATCAGGATCCACTGCAAGGA CGTGCTCCCACACATCAATC
RHOC AATAAGAAGGACCTGAGGCAAGAC ACGGGCTCCTGCTTCATCT
UBL5 AGCTGATTGCAGCCCAAACT TCGTGTACCACTTCTTCAGGACAA