Skip to main content

Table 4 Primer sequences and probe numbers for each assay

From: Novel biomarker combination improves the diagnosis of serious bacterial infections in Malawian children

Gene Forward Primer Sequence Reverse Primer Sequence Universal Probe Library
GNLY AGGGTGACCTGTTGACCAAA CAGCATTGGAAACACTTCTCTG 17
LCN2 TCACCTCCGTCCTGTTTAGG AGGTAACTCGTTAATCCAGGGTAA 61
RETN TGCAGGATGAAAGCTCTCTG CATGGAGCACAGGGTCTTG 45
ACTB ATTGGCAATGAGCGGTTC GGATGCCACAGGACTCCAT 11
B2M TTCTGGCCTGGAGGCTATC TCAGGAAATTTGACTTTCCATTC 42
GAPDH AGCCACATCGCTCAGACAC GCCCAATACGACCAAATCC 60
GNB2L1 GCTACTACCCCGCAGTTCC CAGTTTCCACATGATGATGGTC 55
HMBS AGCTATGAAGGATGGGCAAC TTGTATGCTATCTGAGCCGTCTA 25
HPRT1 TGACCTTGATTTATTTTGCATACC CGAGCAAGACGTTCAGTCCT 73
PGK-1 CTGTGGCTTCTGGCATACCT CTTGCTGCTTTCAGGACCA 42
RPL13A GAGGCCCCTACCACTTCC TGTGGGGCAGCATACCTC 28
RPL32 GAAGTTCCTGGTCCACAACG GCGATCTCGGCACAGTAAG 17
SDHA AGAAGCCCTTTGAGGAGCA CGATTACGGGTCTATATTCCAGA 69
TBP GCTGGCCCATAGTGATCTTT CTTCACACGCCAAGAAACAGT 3
YWHAZ CGTTACTTGGCTGAGGTTGC TGCTTGTTGTGACTGATCGAC 9
  1. 12 endogenous transcripts (ACTB, B2M, GAPDH, GNB2L1, HMBS, HPRT1, PGK-1, RPL13A, RPL32, SDHA, TBP and YWHAZ) were screened and analysed using the GeNORM algorithm [28].