Skip to main content

Table 1 Primer pairs used for direct bisulfite sequencing and combined bisulfite restriction analysis of hypermethylated genes

From: Screening significantly hypermethylated genes in fetal tissues compared with maternal blood using a methylated-CpG island recovery assay-based microarray

Gene GenBank Accession No.   Primer (5' → 3')
PITX2 NM_000325.5 F TAGTGATAGGCGTTTCGGGTT
   R CCACTACATACTAACAAACACTCAAAT
TLX3 NM_021025 F TCGGTTGAGGATTAGAGGGATT
   R AACGCCACCTAACCATCTATTC
OTX2 NM_172337.1 F AGTTGTGTTAGGTTGAGGGAG
   R AATCCCAAAAACCTTTTTAAA
MNX1 NM_001165255 F TTTAAGAAATAGCGAGAGGGAG
   R AAACGCTCGTAACATAATCCC
NR2F2 NM_001145155 F CGTATCGTGGATTTGGAGTAGGGTATT
   R AACAAACTCGCTAACAAATAAACRACATT
TFAP2C NM_003222 F CGAAGTGTTAGGGTTTTGTGTGT
   R CGACCTTAAACAACAACCAAATCC