Skip to main content

Advertisement

Table 1 Sequences of the primers used for Q-PCR analysis

From: Structural, functional and molecular analysis of the effects of aging in the small intestine and colon of C57BL/6J mice

Gene Sequence forward primer Sequence reverse primer
INFγ ATGAACGCTACACACTGCATC CCATCCTTTTGCCAGTTCCTC
IF44 AACTGACTGCTCGCAATAATGT GTAACACAGCAATGCCTCTTGT
IF47 AGCAGATGAATCCGCTGATGT CGTGGAAATTGGGTGTCCC
TNFα CAACCTCCTCTCTGCCGTCAA CGTGGAAATTGGGTGTCCC
IL1β TGGTGTGTGACGTTCCCATT CAGCACGAGGCTTTTTGTTG
IL6 CTTCCATCCAGTTGCCTTCTTG AATTAAGCCTCCGACTTGTGAAG
Cubn GAATGTGGCTCCAAGTCCCAT ACGGCTAATGAAGGATGCAGA
36B4 AGCGCGTCCTGGCATTGTGTGG GGGCAGCAGTGGTGGCAGCAGC