Skip to main content

Table 2 Primer and probe sequences for TaqMan® Custom CN assays

From: Continuing difficulties in interpreting CNV data: lessons from a genome-wide CNV association study of Australian HNPCC/lynch syndrome patients

CNVchr7_CCHSNR9 Sequence hg18 hg19
Forward primer TTCTAGTTTTTAGCAGAAAGTATTTCCTTCTTCA 61,860,925 62,223,490
Reverse primer TTTCATTCAGCTGTTTGGAAACACTATTTT 61,861,034 62,223,599
FAM-dye labelled probe CATAGGCCTCAATGCGCTCCCAA 61,860,960 62,223,525
CNVchr16_CCD1S9P Sequence hg18 hg19
Forward primer CTCCCAAATGTCCATTCACCAAAT 32,453,256 32,545,755
Reverse primer TTTCTTATGTGTGCATTATTCTCACAGA 32,453,355 32,545,854
FAM-dye labelled probe ACCTTTCCTTTGATTCAGCAGTTTT 32,453,299 32,545,798