Skip to main content

Table 4 Primers for sequenom analysis of CpG methylation of the Slc2a4 promoter region

From: Post-weaning selenium and folate supplementation affects gene and protein expression and global DNA methylation in mice fed high-fat diets

Amplicon ID mus_Slc2a4_pp27 mus_Slc2a4_pp46
Genomic co-ordinates chr11:69761390-69761763 chr11:69762346-69762668
Strand
Length 374 323
Sequence CCTGGCCAATGGGTGTT  
GTGAAGGGCGTGTCCTA GGGAAGGGTTAATAGAA
TGGCGGGGCGGGAGTGG GAGAGCCACCCCAGAA
GGAGGTGGCTTCAGCTCT GTTAGCTACCCTGGTGC
CCGCATCTTTCCCCCTCA AATCCACTAAGGTTCCT
AGCGGGTCTCACTAGAT CGCTCTCCCTCTAGGTG
CCCGGAGAGCCTTGGTG GCGCCAGAAGCCTTGC
CTCTCCGGTTCCGTGGGT ACTTCTCTTGGGCCTTTT
TGTGGCAGTGAGTCCCAC TCTGAATTGAGCTCTCTC
CAGACCCGCCCTTTGCAC TCCACATTCTTCGCCAGC
ACGGCTTCCGAACGCCGG TCTCTCCCTGGACGTGCTT
GGTCTCGTGCCGGCCAG AGGTCGTGCCCTCTCAGCT
GCCCGGACCCTATACCC GTAGACCCAAAACAGTAG
TATTCATTTTTTTCTTAT CTGACTCTGGAAAGCTTGT
TGCAGCGCCTGAGTCTT CGCCCACGCGGCCAGCACA
TTCTTCTTTTAAAACAAG TGCCTGGAGGCTCAGGGA
ATGCCGTCGGGTTTCCAG CTTCAGGGAGGGTGGTGT
CAGATCGGCTCTGACGTAA GACTGGCGTGAGCACCTG
GGTTCAGCATACCGGGGC TCCCTTGGGTCCCCTCCAAGA
GAATTGGGAAATCTGGTC  
CAGTTTTTCTTGGGCTGAGTT
Left primer length 23 27
Left primer sequence aggaagagagTTTGGTTAAT aggaagagagGGGAAGGGTTA
GGGTGTTGTGAAG ATAGAAGAGAGTTATT
Right primer length 25 25
Right primer sequence cagtaatacgactcactatagggagaag cagtaatacgactcactatagggagaagg
gctAACTCAACCCAAAAAA ctTCTTAAAAAAAACCCAA
  AACTAAACC AAAACAAA