Skip to main content


Table 4 Primers for sequenom analysis of CpG methylation of the Slc2a4 promoter region

From: Post-weaning selenium and folate supplementation affects gene and protein expression and global DNA methylation in mice fed high-fat diets

Amplicon ID mus_Slc2a4_pp27 mus_Slc2a4_pp46
Genomic co-ordinates chr11:69761390-69761763 chr11:69762346-69762668
Length 374 323
Left primer length 23 27
Left primer sequence aggaagagagTTTGGTTAAT aggaagagagGGGAAGGGTTA
Right primer length 25 25
Right primer sequence cagtaatacgactcactatagggagaag cagtaatacgactcactatagggagaagg