Skip to main content

Advertisement

Table 2 The primers for clone sequencing

From: DNA methylation study of fetus genome through a genome-wide analysis

Primer name Forward primer Reverse primer Amplicon size (bp)
FH1 GGAGTTTTTTATGTATTTGGTATTT CATACCCCCAAAAAATAAAATTTAAAATCT 383
FH2 ATGGGGAAGTAGATTTGGGTAT TCACTTTAACTACCCCCAAATATTATAA 456
FH3 TAGGGGTGTTATGAAGGTGGTA ATTCTATATAATCACTTCCACATTCTTAAT 418
FH4 AGGGTTGGGTAATATTTTTATTGTTATAAT ACAAACCAAATTACCCCCATT 492
FH5 ATGGGAGGTGGGTTTTGTT AAAATCACCTACCAACCTCAATAACTA 446
FH6 GGTTTTTTAGATTTGGATGTGATTTAGG CCCCCCCATAAATAAAACCTT 470
FH7 GTGGAGATAGTAGTGAGTAGAGA AATCCCATATAAACCCAAACCT 484
FH8 TTTTTTTTGTAGTTTAGGGTTTTTTGTAT CTCTTCTAAAACATCCACCTTACA 391
FH9 TGAGAAATTTAAGGAGTGTGTGT TACCCCCATCTATCCTATACTCT 452
FL1 GGGAGGAAGGAGTTGGTAGGTTTTTAT ACTACCCAAATCTCTCACTTTACAATAAC 357
FL2 GTTTTTAGTTAAGTTTTTTGGGGAGAGG AACAACTAATTTCACACCATATCTTAT 349
FL3 TGGGAAGTATGTGGAAGTGGA CACCCCCCATTTTAAAAACAACAATCTAT 290
FL4 GGAAATGTGTTAAGGTAAGAGGTTATAAG CCAAAACTTCTACCCCTAAAAAT 452
FL5 TTTTGTTAAGAATAATAAGAGAGGGTAAGT ATCTATAAATCTTTTTTCCAAACTCAC 481
FL6 GGGTTTTTTGTTTAATTGTGTATTGGAG ACCTAACCAAACCCCATACT 388
FL7 GGATTATTAGTTGTATAATTATGGAGATT ACCCCCTCTCTACTACTAATATAA 378
FL8 AAGGGGATTTTTTTGGAAAGTAT CATCTCAAACTCTCACCATCATAAATA 489
FL9 GTGTTTAGTAATAGGTAGTTTGGAAAATT CTTACTTACAATTCCAATACCTATAATCAC 435
FL10 TGGTATTAGTGGGAGTTTAATAGATG AACTCAAATAAACCCACATACACTATAAT 413
FL11 TGGATTGATATAGGGAAAAAAAAGGAGAA CACTCCCAAATCTCTACTAACCTCTA 465
FL12 GTGGGTTTTATTTAGGTTGTGAGTA CTTAAACTCCTCTTCCCCAACAC 350
  1. FH indicates fetus hypermethylation DNA markers and FL indicates fetus hypomethylation DNA markers.