Skip to main content

Table 10 The primers used for miRNA qPCR

From: MicroRNA and mRNA expression profiling in rat acute respiratory distress syndrome

rno-miR-30b-FW TGTAAACATCCTACACTCAGCTA
rno-miR-99a-FW AACCCGTAGATCCGATCTTGTG
rno-miR-126-FW TCGTACCGTGAGTAATAATGCGA
rno-miR-26a-FW TTCAAGTAATCCAGGATAGGCTA
U6 RNA-FW GCAAGGATGACACGCAAATTC
General-RE GCGAGCACAGAATTAATACGAC
PolyT adapter GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN