Skip to main content

Table 1 Primers used for real-time PCR and real-time PCR validation of RNA-seq results

From: RNA sequencing from human neutrophils reveals distinct transcriptional differences associated with chronic inflammatory states

Gene ID Primer direction Primers sequence (5′ ~ 3′) Fold change (AD vs CRM)
RNA-seq qPCR
DDX60 Forward GAA GCA GCA GGA AGC TGA A −5.73 −1.26
  Reverse GGA TGT CTC TCA GTT GCT CAA A   
IFIH1 Forward TTG GAT AAG TGC ATG GAG GAG −3.61 −1.53
  Reverse CCT GTT TGA CGA AGA ACA TTC AG   
IFITM3 Forward CCT GTT CAA CAC CCT CTT CA −5.30 −1.82
  Reverse CAT GAG GAT GCC CAG AAT CA   
IGHMBP2 Forward ACG AAC AGT CGA AAG GGA AC 2.99 1.10
  Reverse AGC CAT CGA CAG ACT TGA TTT   
MOV10 Forward GGG CTA TGA CCT GGA GTT AAG 1.44 −3.50
  Reverse CAC CTC ATA GTT CCT CCA CTT C   
OAS1 Forward GAA GCC TGT CAA AGA GAG AGA G −13.46 −1.24
  Reverse GTT AGG TTT ATA GCC GCC AGT   
PML Forward ACA ACA TCT TCT GCT CCA ACC −2.64 2.21
  Reverse TGT CGC TGC TGG ATC TCT   
RNF213 Forward CTG GTT GTG TCA CCT CCT AAC −3.07 1.46
  Reverse GTC CTT GTG TCC ATG CAT CT   
TNFAIP6 Forward GAT GGG ATG CCT ATT GCT ACA −2.79 −3.70
  Reverse CGC TGA CCA TAC TTG AGT CTA AT   
TRIM5 Forward GCA GGA AGC TGA AGA GTT AGA −1.33 −2.58
  Reverse GAA TGT CTT CCT CCT CCT TCT C   
lnc-CKAP2L-1 Forward GTTAAAGCTGCGAAGAACCTAAC 13.94 1.19
  Reverse TTCCTGCCTCTTCCTACTCT   
lnc-IFITM2-4 Forward GATCTTAGCCTTGGCCTCAC −7.98 −24.85
  Reverse TACACCAGGCAACCACAAATA   
lnc-IRS2-2 Forward GCTAGTTCAGCCTGTGAGATG 17.2 6.69
  Reverse AGCAAGCAATCCAAGAGAGAG   
lnc-PFDN4-1 Forward GGTGTTTGGAGACAAAGGAATAG 3.77 1.28
  Reverse CTATCTCGTGCCGCTTAGTATC   
lnc-PML-1 Forward TGTAGCACTCACGGCAAAT −6.16 −2.39
  Reverse CGTGTCCAGAGTTTGTTCCT   
lnc-RBL2-1 Forward TCCTGAGTAGCTGGGAT GTA −2.2 −1.61
  Reverse GACCAGCCTAGCCAACATAAT   
lnc-SLC2A13-1 Forward TAATGGCAGTGGAGGTTGTC −2.78 −3.39
  Reverse GAACTTCCAGCATCTCCTTACA