Skip to main content

Table 2 Top 20 of the most abundantly expressed miRNAs

From: MicroRNA involvement in mechanism of endogenous protection induced by fastigial nucleus stimulation based on deep sequencing and bioinformatics

miR_name miR_seq len Copy of the miRNA
rno-miR-125b–5p TCCCTGAGACCCTAACTTGTGA 22 94,525
rno–miR–219a–2–3p AGAATTGTGGCTGGACATCTGT 22 92,142
rno–miR–127–3p TCGGATCCGTCTGAGCTTGGCT 22 28,705
rno–let–7f–5p TGAGGTAGTAGATTGTATAGTT 22 18,363
rno–let–7i–5p TGAGGTAGTAGTTTGTGCTGTT 22 13,509
rno–miR–27b–3p TTCACAGTGGCTAAGTTCTGC 21 10,614
rno–let–7c–5p TGAGGTAGTAGGTTGTATGGTT 22 10,424
rno–miR–128–3p TCACAGTGAACCGGTCTCTTT 21 8521
rno–miR–379–5p TGGTAGACTATGGAACGTAGG 21 8379
rno–miR–181a–5p AACATTCAACGCTGTCGGTGAGT 23 8345
rno–miR–132–3p TAACAGTCTACAGCCATGGTCG 22 7192
rno–miR–29b–3p TAGCACCATTTGAAATCAGTGTT 23 6772
rno–let–7a–5p TGAGGTAGTAGGTTGTATAGTT 22 6511
rno–let–7b–5p TGAGGTAGTAGGTTGTGTGGTT 22 6388
rno–miR–218a–5p TTGTGCTTGATCTAACCATGT 21 6104
rno–miR–129–5p CTTTTTGCGGTCTGGGCTTGC 21 5216
rno–miR–434–3p TTTGAACCATCACTCGACTCCT 22 5113
rno–miR–99b–5p CACCCGTAGAACCGACCTTGCG 22 4921
rno–miR–25–3p CATTGCACTTGTCTCGGTCTGA 22 3456
rno–miR–148b–3p TCAGTGCATCACAGAACTTTGT 22 3332