Skip to main content

Table 2 Primer sequences of the amplified fragments

From: Histamine H4 receptor gene polymorphisms: a potential contributor to Meniere disease

SNP Sequence (5′ to 3′) Product size (bp)
rs77485247 T > A
(ss142022671)
F: TGGAGATGGATGCATCACAG
R: TCCCCAGTTGTATACAGTC
566