Skip to main content

Table 3 The sequences of double-stranded oligonucleotide probes used for EMSA

From: DNA methylation status of TBX20 in patients with tetralogy of Fallot

Probe Sequences(5′-3′)
Biotin-TBX20–708/−684-F GTAGAGCTCCGCGCCCTGACCTTCG
Biotin-TBX20–708/−684-R CGAAGGTCAGGGCGCGGAGCTCTAC
Biotin-TBX20–708/−684mut-F GTAGAATCAAAAATTTCACACTTCG
Biotin-TBX20–708/−684mut-R CGAAGTGTGAAATTTTTGATTCTAC
Unlabeled-TBX20–708/−684mut-F GTAGAATCAAAAATTTCACACTTCG
Unlabeled-TBX20–708/−684mut-R CGAAGTGTGAAATTTTTGATTCTAC
Me-TBX20–708/−684-F GTAGAGCTCCGCGCCCTGACCTTCG
Me-TBX20–708/−684-R CGAAGGTCAGGGCGCGGAGCTCTAC