Skip to main content

Table 1 PCR and sequencing primersa for bisulfite pyrosequencing

From: Unbalanced segregation of a paternal t(9;11)(p24.3;p15.4) translocation causing familial Beckwith-Wiedemann syndrome: a case report

Region Primer Sequence (5′ to 3′) CpGs Chromosomal localization (bp)b Amplicon size (bp) Sequence to analyze
ICR1 Forward TGGGTATTTTTGGAGGTTTTTTT 4 Chr11: 2,020,978 - 2,021,291 314 YGYGTYGTAGGGTTTAYGGGGGTT
Reverse cAACTTAAATCCCAAACCATAACA
Sequencing GTTTYGGGTTATTTAAGTTA
ICR2 Forward TTGTTTATAAGGTGTAGATGGGAG 4 Chr11: 2,720,465 - 2,720,669 205 AYGTTTGTGATTTGGGAYGGTYGYGGGGTATATAGTTTATT
Reverse cTCTCCCAAACTCTCCTCAAC
Sequencing TAGGTTAGGTTGTATTGTTG
  1. aAdopted from Paganini et al., 2015 [12]
  2. bGenomic coordinates are based on Ensembl release 75
  3. cPrimer is biotinylated at the 5′ end