Skip to main content

Table 1 Differentially expressed microRNAs list

From: Identification of genes and miRNA associated with idiopathic recurrent pregnancy loss: an exploratory data mining study

Name State Sequence Fold change P-Value
hsa-miR-146a-5p UP UGAGAACUGAAUUCCAUGGGUU 4.45436783 0.0009
hsa-miR-125a-5p UP UCCCUGAGACCCUUUAACCUGUGA 2.79 < 0.001
hsa-miR-155-5p UP UUAAUGCUAAUCGUGAUAGGGGUU 3.96 < 0.001
hsa-miR-221-3p UP AGCUACAUUGUCUGCUGGGUUUC 7.409 0.0070
hsa-miR-146b-5p UP UGAGAACUGAAUUCCAUAGGCUG 5.108 0.0087
hsa-miR-320b UP AAAAGCUGGGUUGAGAGGGCAA 2.637 0.0022
hsa-miR-133a-3p UP UUUGGUCCCCUUCAACCAGCUG 0.009684 < 0.001
hsa-miR-101-3p UP UACAGUACUGUGAUAACUGAA 3.614 0.0193
hsa-miR-223-3p UP UGUCAGUUUGUCAAAUACCCCA 5.7 < 0.001
hsa-miR-92a-3p UP UAUUGCACUUGUCCCGGCCUGU 2.662 0.0308
hsa-miR-148b-3p UP UCAGUGCAUCACAGAACUUUGU 4.595 0.0434
hsa-miR-30d-5p UP UGUAAACAUCCCCGACUGGAAG 4.361 0.0285
hsa-miR-23b-3p UP AUCACAUUGCCAGGGAUUACCAC 3.430 0.0210
hsa-miR-423-3p UP AGCUCGGUCUGAGGCCCCUCAGU 2.01 0.0332
hsa-miR-145-5p UP GUCCAGUUUUCCCAGGAAUCCCU 0.722968 0.5116
hsa-miR-16-5p UP UAGCAGCACGUAAAUAUUGGCG 0.879078 0.3559
hsa-miR-181a-5p UP AACAUUCAACGCUGUCGGUGAGU 2.854288 0.0925
hsa-miR-424-5p UP CAGCAGCAAUUCAUGUUUUGAA 0.127032 0.8565
hsa-miR-30d-5p UP UGUAAACAUCCCCGACUGGAAG 0.604136 0.1879
hsa-miR-143-3p UP UGAGAUGAAGCACUGUAGCUC 1.336424 0.2162
hsa-miR-27b-3p UP UUCACAGUGGCUAAGUUCUGC 1.052276 0.4425
hsa-miR-17-5p Down CAAAGUGCUUACAGUGCAGGUAG 0.35 0.0020
hsa-miR-19b-3p Down UGUGCAAAUCCAUGCAAAACUGA 0.34 < 0.001
hsa-miR-559 Down UAAAGUAAAUAUGCACCAAAA 0.390 0.0150
hsa-miR-365a-3p Down UAAUGCCCCUAAAAAUCCUUAU 0.321 0.0318
hsa-miR-1182 Down GAGGGUCUUGGGAGGGAUGUGAC 0.238 0.0186
hsa-miR-4284 Down GGGCUCACAUCACCCCAU 0.428 0.0079
hsa-miR-4264 Down ACUCAGUCAUGGUCAUU 0.113 0.0013
hsa-miR-4474-5p Down UUAGUCUCAUGAUCAGACACA 0.196 0.0399
hsa-miR-22-5p Down AGUUCUUCAGUGGCAAGCUUUA 0.337 0.0172
hsa-miR-372-5p Down CCUCAAAUGUGGAGCACUAUUCU 0.22803727 0.0021
hsa-miR-451a Down AAACCGUUACCAUUACUGAGUU −1.31401 0.0592
hsa-miR-21-5p Down UAGCUUAUCAGACUGAUGUUGA −1.45161 0.4086
hsa-miR-149-5p Down UCUGGCUCCGUGUCUUCACUCCC −1.530395 0.1853
hsa-miR-181b-5p Down AACAUUCAUUGCUGUCGGUGGGU −2.329242 0.0434