Skip to main content

Table 2 The primers for real-time quantitative reverse transcription PCR

From: LRIG1 expression and colorectal cancer prognosis

Gene name Primer sequence Product size (bp) Annealing temperature (°C)
LRIG1 F: CTGCATGAGTTGGTCCTGTCC 112 60
  R: TGTGGCTGATGGAATTGTGG   
GAPDH F:GCAGGGGGGAGCCAAAAGGGT 219 60
  R: TGGGTGGCAGTGATGGCATGG   
  1. LRIG1 leucine-rich repeats and immunoglobulin-like domain-1, GAPDH Glyceraldehyde-3-phosphate dehydrogenase