Skip to main content

Table 4 Primer sequences used for genotyping in ARMS-PCR

From: Association of PICK1 and BDNF variations with increased risk of methamphetamine dependence among Iranian population: a case–control study

SNPs Primers Sequences Primer Length (bp) PCR products (bp)
rs6265 FO CTACAGTTCCACCAGGTGAGAAGAGTG 27 400
RO ATGGACATGTTTGCAGCATCTAGGTA 26
FI (c) TGGTCCTCATCCAACAGCTCTTCTATaAC 29 253
RI(t) TTGGCTGACACTTTCGAACcCA 22 201
rs713729 FO CTTTCTAGCGGAATCCCGACTGTG 24 407
RO CAGTGAAAAAGCAAACCAGGACACTG 26
FI(a) CTTCTCATTCTTGAGGTCTGACCCACA 27 196
RI(t) AGGTGGTCAGAAAGCCCCTCAGA 23 265
rs2076369 FO CATGTTGCCCAAGCTGGTCTCAAACTC 27 299
RO CTGGACACCCGTAACTGCTCTGACC 35
FI(g) AGGAGTCTCAGTCCAGAACAGTCTTGACG 29 191
RI(t) CTCCACACCCTGAGCCCCTTCTCA 24 165
  1. Expected product size in bps depending on the SNPs. FO: Forward outer primer; FI: Forward inner primer; RI: Reverse inner primer; RO: Reverse outer primer; bp: Base pairs; ARMS-PCR: Amplification refractory mutation system-polymerase chain reaction; SNP: Single nucleotide polymorphism