Skip to main content

Table 2 The primers used for qRT-PCR

From: Competing endogenous RNA network analysis explores the key lncRNAs, miRNAs, and mRNAs in type 1 diabetes

Primers Sequences (5′–3′)
GAS5-hF CACACAGGCATTAGACAGA
GAS5-hR GCTCCACACAGTGTAGTCA
TRG-AS1-hF CTCCTTCATTCCCTATTC
TRG-AS1-hR TTATGATGGCTACGATGT
PPM1L-hF GAGACCCGAGACGCTTTTCC
PPM1L-hR GGCTGGACTTCACGATGGT
SERPINA1-hF ATGCTGCCCAGAAGACAGATA
SERPINA1-hR CTGAAGGCGAACTCAGCCA
hsa-miR-320a-3p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGCGA
hsa-miR-320a-3p-F GCGCGTCTCAACCCAGCTTTT
hsa-miR-23b-3p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTACCAC
hsa-miR-23b-3p-F GCGCATCCCTGGCAATGTGAT
hsa-miR-423-5p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGACTTT
hsa-miR-423-5p-F GCTCGCTCTCTGCCCCTCA
Universal primer GTGCAGGGTCCGAGGT
hsa-U6-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATG
hsa-U6-F CTCGCTTCGGCAGCACA
hsa-U6-R AACGCTTCACGAATTTGCGT