Skip to main content

Table 2 Primers in this study

From: The identification of circular RNAs from peripheral blood mononuclear cells in systemic lupus erythematosus

Gene name Forward (5′–3′) Reverse (5′–3′)
hsa_circ_101260 CGCCCCATTTGTACACCATG GCAGGCTCCCAACCATGATA
hsa_circ_101413 CTACGACCCACAGCAGAAGA GCTTTAGTTTCTCGGGCAGG
hsa_circ_102489 GAACAAGCCATCCACTCCAG TTCACTTCCAAGCACAGCAC
hsa_circ_103906 AAAGGGGATGAAGCCTGGAA CTCCACTCAAGGTCCTCACT
hsa_circ_100263 GACTACCGTTCCCTTGAGCT GTCCTGATCTCCCGGTGTAA
hsa_circ_104081 ACTCTTCACTGCCATTGGTT TCTTTCTTACCCCACAACCCA
hsa_circ_103421 CATTGTGAGTGTGCTAGCCC GCTTCCACTTCTCTCCTCGT
hsa_circ_101269 ACGGGAAGAAGCATGGGTTA ACTGTGAGTCTTTGGCCAGT
hsa_circ_104102 CCGGAATTCAAAACCTGGCA CACGGTTCTCAACATCAGCA
hsa_circ_101705 AGAATCTCACTCTGCTGCCC TGGTGAATGGTGGATGGTTTG
GAPDH ATGGGGAAGGTGAAGGTCG GGGGTCATTGATGGCAACA