Skip to main content

Table 2 MassARRAY primers

From: MassARRAY multigene screening combined with LDL-C and sdLDL-C detection for more favorable outcomes in type 2 diabetes mellitus therapy

Gene SNP_ID Forward primer sequence Reverse primer sequence UEP sequence
HTR3B rs2276307 ACGTTGGATGAAGTCCCTGTTCTTGGGTGA ACGTTGGATGCTTTGGCCTTCTCTCTTGGG CTCTTGGGCCAAGGA
APOE rs7412 ACGTTGGATGGCCCCGGCCTGGTACACTG ACGTTGGATGACCTGCGCAAGCTGCGTAA CGATGACCTGCAGAAG
APOE rs429358 ACGTTGGATGGAGCATGGCCTGCACCTCG ACGTTGGATGCTGTCCAAGGAGCTGCAGG ATGACATGGAGGACGTG
CYP2C9*3 rs1057910 ACGTTGGATGATGCAAGACAGGAGCCACAT ACGTTGGATGTGTCACAGGTCACTGCATGG GTGGGGAGAAGGTCAA
KIF6 rs20455 ACGTTGGATGCCGGTGAGTTCTCACCTTAC ACGTTGGATGCGATCACACGAAGCCATTTC CTGACTCCCAGCATGAA
HMGCR rs17238540 ACGTTGGATGGGACACAATGGATTAGGCTG ACGTTGGATGGAGACTATGTATCACTCACC GGTCTTTTCCAAACTCTTT
HMGCR rs17244841 ACGTTGGATGCACACCATTGCACATTGCAC ACGTTGGATGCAGGTATTCAAGATACAAAG AAGTATGATTGTAATATAAAGGATTT
ABCB1 rs2032582 ACGTTGGATGGTCTGGACAAGCACTGAAAG ACGTTGGATGAGTAAGCAGTAGGGAGTAAC CCTCTGACTCACCTTCCCAG
HTR7 rs1935349 ACGTTGGATGGTGTCTGTGGTCAGGTGATA ACGTTGGATGTATTTCCTTGGCTGCCAGTC AAATAGATTGTCCAGACATGA
SLCO1B1 rs4149056 ACGTTGGATGAATCTGGGTCATACATGTGG ACGTTGGATGCCAATGGTACTATGGGAGTC CCCAAGCATATTACCCATGAAC
CETP rs708272 ACGTTGGATGTGTCTGAGACCCAGAATCAC ACGTTGGATGTCTTTACCCCCTGACTCAAC CGGCGCAGATCTGAACCCTAACT