Skip to main content

Table 1 Primers used for qRT–PCR of lncRNA and mRNA expression

From: Genome-wide analysis of long noncoding RNA expression profile in nasal mucosa with allergic rhinitis

lncRNA/mRNA Forward primer (5′–3′) Reverse primer (5′–3′)
lnc-CBR1-3 GGTCAAGCCAAGCCAACAG GTCCTCAGCACCACTTATTAGT
lnc-HPR-1 GAGGCACAGACAGGTTGAGTA CGGTCACAGCCAAGCAGTA
lnc-SEPT7L-5 CCATGCCATTCAGGTCCAATC GGAATGGATGCGAATGGAATGA
DLGAP1-AS1 TATCTGAGAGCCAGCGAACTT CTTCATAGCCTGTTGCGTCAT
lnc-CXCL12-4:1 GACCGCTCCCGCCTAATG TGCTTAGCCCTCCGGATACC
lnc-CXCL12-4:2 CTACAGATGCCCATGCCGAT AGGTTGGACACTTGGCTTGT
MUC7 GCTTGCTTCTCGTTCAGT GTGATGATGCCTTCTGTGA
IGFBP3 GTCCTCCTTAGCACAATGTA TCCTCCTTCCTGTTCTGATA
CXCL12 GACAAGTGTGCATTGACCCG GCCCTTCCCTAACACTGGTT
CXCR4 AACTTCAGTTTGTTGGCTGCG GATCCCCTCCATGGTAACCG
GAPDH TGTTGCCATCAATGACCCCTT CTCCACGACGTACTCAGCG