Skip to main content

Table 1 The primer sequence of STR loci

From: DMD/BMD prenatal diagnosis and treatment expectation in a single centre in China for 15 years

Probe name Length (in bp) Forward/reverse primer (5′–3′)
5′-(CA)n-3′ 206–228 tcttgatatatagggattatttgtgtttgttatac/attatgaaactataaggaataactcatttagc
DMDSTR07A 218–335 ttctggttttctggtctg/gaatcaatctctctgtcaag
STR-44 180–200 tccaacattggaaatcacatttcaa/tcatcacaaatagatgtttcacag
STR-45 152–178 gaggctataattctttaactttggc/ctctttccctctttattcatgttac
STR-49 223–260 cgtttaccagctcaaaatctcaac/catatgatacgattcgtgttttgc
STR-50 232–244 aaggttcctccagtaacagatttgg/tatgctacatagtatgtcctcagac
3′MP1P 65–81 atgatcagagtgagtaatcggttgg/atatcgatctagcagcaggaagctgaatg
D21S1919 168–198 agcggactgcatgaatcaca/gcgtctatcactctcatgttccta
D21S263 194–229 tacaagttaagggtgaaattggcta/gcgtcttcatcagcaagcgtcctctta
D21S1914 258–280 ccttctgtcacattatgaggaaaca/gcgtcttaaaggtatgattcactaaa
D21S1255 308–329 ctcttgattatgccacatagac/gcgtcttgctcgcagatgtttatta