Skip to main content

Table 1 Primers for direct sequencing of IHH

From: Deletion of 2 amino acids in IHH in a Japanese family with brachydactyly type A1

Exon Forward primer (5'-3') Reverse primer (5'-3')
1 CGGCCTATTTATTGGCGG (PCR) TGCCAGCCAGTCGAGAAAAT
GCACCACGCCGCCCATGG (Sequencing)
2 TTCCAGCTCCCTTGGGTGT ATGTCCTCTTCCCCCGGAT
3 ATATGGTGACGGGGGCTCT ATCTTCATGGCAGAGGAGATG