Skip to main content

Table 1 The primer sequences of genes in this experiment

From: Identification and validation of pivotal genes related to age-related meniscus degeneration based on gene expression profiling analysis and in vivo and in vitro models detection

Target genes Species Forward primer Reverse primer
RRM2 Homo GTTTGTGGCAGACAGACTTA TCACTCCCATCCTCTGATAC
RRM2 Mouse TAGGCGAGTATCAGAGGATG GTGTAGCCAGTTGGTTGTT
AURKB Homo CCAGAAGGTGATGGAGAATAG CCCATGGCAGTACATTAGAG
AURKB Mouse CTACAAGGAACTGCAGAAGAG CAGGTTCTCCGGCTTTATG
CDK1 Homo GTCAGCTCGTTACTCAACTC CTTCTGGCCACACTTCATTA
CDK1 Mouse CATGGTCAGAGGTAGGTTAGA CTAAGCAGCACAGCGATAC
TIMP1 Homo CCACCTTATACCAGCGTTATG CAGGTAGTGATGTGCAAGAG
TIMP1 Mouse GGCATCCTCTTGTTGCTATC GGTGGTCTCGTTGATTTCTG
GAPDH Homo GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC
GAPDH Mouse AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
  1. RRM2 ribonucleotide reductase regulatory subunit M2; AURKB aurora kinase B; CDK1 cyclin dependent kinase 1; TIMP1 tissue inhibitor of metalloproteinases 1; GAPDH glyceraldehyde phosphate dehydrogenase