Skip to main content

Table 2 The primer sequences used in this study

From: Transcriptome sequencing reveals a lncRNA–mRNA interaction network in extramammary Paget’s disease

ID Primer sequence (5′–3′) Product length (bp)
FKBP5 F: AGCAGGGAGAGGATATTACC
R: TCATCGGCGTTTCCTCAC
87
CDON F: CTGCATCAGAGACATCAGTCTA
R: GGTCCTCATCCGTTTATATTCG
98
PGAP1 F: CCAGATAAATCAGTTGACCCAC
R: CTTCAAATGCAGCACTGTAAAG
112
NEAT1 F: TAGCATGTTTGACAGGCGG
R: AGTTTAGCGCCAAACCTAGA
126
SNHG3-203 F: TTTGCTTATCAGCTCTTTGTCA
R: AGAGGTAAATCCTGACCAACT
86
TERC-201 F: CCTAACTGAGAAGGGCGT
R: GCTCTAGAATGAACGGTGG
116
SNHG12-202 F: TGTGACTATGGACCTATGGAG
R: GCATGCTGTTGTTTCTACCTAA
89
ENST00000610809 F: CACAAAGGAACGTAGACAAATG
R: ATGAGGTGGGCTTGTTTGAA
80
ENST00000443132 F: CTTTGATCTTCTGTGATAGCGA
R: TTCTTCCAAGGGGCAGGATAA
107
ENST00000619523 F: ACAGATCATCCTGTCCTCC
R: ACACACTCTTCCAAGCAC
86