Skip to main content

Table 1 Information for SMAD7 SNPs primers

From: Association of SMAD7 genetic markers and haplotypes with colorectal cancer risk

SNP Primer sequence Primer type Tm PCR product size  
rs4939827 CTCATCCAAAAGAGGACAC Forward inner (C Allele) 54 140 bp 270 bp
  GTTTTCTGATTAACTCGCAGT Reverse outer    
  ATTCACAAGGACCCTTGCT Forward outer 58 167 bp  
  AGGGAGCTCTGGGGTCATA Reverse inner (T Allele)    
rs34007497 AGACTCCTGCCTGCTCCTCTC Forward inner (C Allele) 64 203 bp 553 bp
  TCCCCAGAAGGTGTGATGTCCA Reverse outer    
  AGTGAGTGGAGTATGGACCTGAGATCG Forward outer 64 393 bp  
  GGGGAGCTGGAGGGGACAGCCAC Reverse inner (G Allele)    
rs8085824 GTCCCCCTTCTCCCCTGCC Forward inner (C Allele) 62   191bp
  CGTCCCCCTTCTCCCCTGCT Forward inner (T Allele)    
  CCTTACCAGAATCACCCCG Reverse outer    
rs8088297 TAATAGCAGAGCTTAACACACAAGA Forward inner (A Allele) 62 136 bp 309 bp
  TCACAGTATTGCTCACCCAGT Reverse outer    
  TGAGCTAAGAACAGTGTCGAAGTA Forward outer 70 217 bp  
  TCAGCACTGCCTGCTCCTAG Reverse inner (C Allele)