Skip to main content
Fig. 4 | BMC Medical Genomics

Fig. 4

From: Diverse cardiac phenotypes among different carriers of the same MYH7 splicing variant allele (c.732+1G>A) from a family

Fig. 4

Sanger sequencing confirmed that the pregnant woman carried the MYH7 gene mutation (upper panel, red arrow), while her husband did not (lower panel). The mutation replaced the canonical splice donor sequence GT to GA (blue box), which is expected to disrupt RNA splicing and likely result in an absent or disrupted protein product. Primers used in this study were as below: chr14-23900793-F: ATGGCACTCACAGGTCTCTATG; chr14-23900793-R: GTACTTTGCTGTTATTGCAGCC. The length of the PCR product was 415 bp

Back to article page

BMC Medical Genomics

ISSN: 1755-8794

Contact us