Skip to main content

Table 1 The primer pairs used in the present study

From: A newly identified mutation (c.2029 C > T) in SLC26A4 gene is associated with enlarged vestibular aqueducts in a Chinese family

Gene Forward sequence (5′–3′) Reverse sequece (5′–3′)
SLC26A4(c.2029) GCTGAGGTGAAACCCATCCT AGCCCATGTATTTGCCCTGT
SLC26A4(c.2168) CCACAAGGTTGACTACGACCA CCAGATGCGCTACTGTTGTG
SLC26A4 qPCR GTGGGATCTGTTGTTCTGAGCAT GGCACTGGCAATCAGGACTC
Actin qPCR CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT