Skip to main content

Table 1 Summary of the MYO15A variants identified in this study

From: Analysis of the genotype–phenotype correlation of MYO15A variants in Chinese non-syndromic hearing loss patients

Nucleotide change Protein change Exon Number of patient Hearing level Variant type Criteria for pathogenicity ACMG classification MAF (gnomAD in east Asian) MAF (gnomAD in total) References
c.198_199delCC p.Gln68Glufs*158 2 1 Severe Frameshift PVS1_Very Strong,PM2_Moderate, LP NA NA  
c.220_221delAG p.Arg74Glufs*153 2 1 Profound Frameshift PVS1_Very Strong,PM2_Moderate,PP3_Supporting P NA NA  
c.596C > G p.Ser199Ter 2 1 Severe Nonsense PVS1_Very Strong,PM2_Moderate,PP3_Supporting P NA NA  
c.735C > G p.Tyr245Ter 2 1 Profound Nonsense PVS1_Very Strong,PM2_Moderate,PP3_Supporting P NA NA  
c.900delT p.Pro301Argfs*142 2 1 Profound Frameshift PVS1_Very Strong,PM2_Moderate LP NA NA  
c.1101del p.Tyr368Thrfs*76 2 1 Moderately severe Frameshift PVS1_Very Strong,PM2_Moderate LP NA NA  
c.1179insC p.Glu396Argfs*36 2 2 Mild to profound Frameshift PVS1_Very Strong,PP5_Strong,PP4_Moderate P 0.0000643 0.000334 Bashir (2012)
c.1185dupC p.Glu396Argfs*36 2 1 Profound Frameshift PVS1_Very Strong,PP5_Strong,PM2_Moderate P 0.000334 0.0000643 Bashir (2012), Miyagawa (2013)
c.1201delT p.Tyr401Thrfs*43 2 1 Moderately severe Frameshift PVS1_Very Strong,PM2_Moderate LP NA NA  
c.1261C > T p.Pro421Ser 2 1 Mild Missense PM2_Supporting,BP4_Supporting U 0.000167 0.0000121  
c.1651G > A p.Ala551Thr 2 1 Severe Missense PM2_Supporting,BP4_Supporting U 0.000358 0.0000269  
c.2231C > A p.Ser744Ter 2 1 Profound Nonsense PVS1_Very Strong,PM2_Moderate LP NA NA  
c.2957delC p.Thr986Ter 2 1 Moderate Frameshift PVS1_Very Strong,PM2_Moderate LP NA NA Nal (2007)
c.3118delC p.Lys1042Argfs*16 2 1 Profound Frameshift PVS1_Very Strong,PM2_Moderate LP 0.0000556 0.00000402  
c.3136delC p.Lys1048Argfs*10 2 1 Severe Frameshift PVS1_Very Strong,PM2_Moderate LP NA NA  
c.3354G > T p.Met1118Ile 2 1 Severe Frameshift PM2_Supporting,PP3_Supporting U NA NA  
c.3524dupA p.Ser1176Valfs*13 2 3 Moderate to profound Frameshift PVS1_Very Strong,PP5_Strong,PM2_Moderate P 0.00195 0.000142 Li (2016)
c.3602G > A p.Arg1201Gln 2 2 Moderately severe to profound Missense PM2_Supporting,BP4_Supporting U 0.0000164  
c.3700C > T p.Gln1234Ter 4 1 Profound Nonsense PVS1_Very Strong,PM2_Moderate,PP3_Supporting P NA NA  
c.3829C > T p.Gln1277Ter 5 1 Profound Nonsense PVS1_Very Strong,PM2_Moderate,PP3_Supporting P NA NA  
c.3866 + 1G > A splicing Intron 5 2 Profound Nonsense PVS1_Very Strong,PM2_Moderate,PP5_Moderate,PP3_Supporting P 0.0000161 Nal (2007),Naz (2017)
c.3926A > T p.Gln1309Leu 6 1 Profound Missense PM2_Strong,PP3_Supporting U 0.0000556 0.00000401  
c.3971C > A p.Ala1324Asp 7 2 Profound Missense PP5_Strong,PM2_Moderate,PP3_Supporting LP 0.0000556 0.00000401  
c.4037A > G p.Lys1346Arg 8 2 Profound Missense PVS1_Very Strong,PM2_Supporting U NA NA  
c.4198G > A p.Val1400Met 10 1 Moderately severe Missense PP5_Very Strong,PM2_Moderate,PP3_Supporting P 0.0000556 0.0000361 Manzoli (2016),Cengiz (2010)
c.4252G > A p.Gly1418Arg 11 1 Profound Missense PM2_Strong,PP5_Moderate,PP3_Supporting LP 0.00000803 Park (2014)
c.4310A > G p.Tyr1437Cys 11 1 Profound Missense PM2_Strong,PP5_Moderate,PP3_Supporting LP 0.0000122 Sloan-Heggen (2016)
c.4322G > T p.Gly1441Val 11 1 Severe Missense PP5_Very Strong,PM2_Strong,PP3_Supporting P    
c.4430G > A p.Arg1477His 12 1 Moderately severe Frameshift PM2_Moderate,PP3_Supporting U 0.0000361  
c.4441 T > C p.Ser1481Pro 13 4 Profound Missense PM2_Moderate,PP3_Supporting U 0.0000556 0.00000401 Cengiz (2010), Diaz-Horta (2012)
c.4519C > T p.Arg1507Ter 13 1 Profound Missense PVS1_Very Strong,PM2_Moderate,PP3_Supporting,PP5_Supporting P 0.00000401  
c.4567C > A p.Leu1523Met 13 1 Moderately severe Missense PM2_Moderate,PP3_Supporting U NA NA  
c.4596 + 1G > A splicing Intron 13 1 Profound Splicing PVS1_Very Strong,PM2_Moderate,PP5_Moderate,PP3_Supporting P 0.0000122  
c.4642G > A p.Ala1548Thr 14 1 Profound Missense PM2_Moderate,PP3_Supporting U 0.0000201 Atik (2015)
c.4676 T > C p.Leu1559Ser 15 1 Profound Missense PM2_Moderate,PP3_Supporting U 0.00000401  
c.4777G > A p.Glu1593Lys 15 2 Profound Missense PM2_Strong,PP3_Strong P 0.0000656 Sloan-Heggen (2016)
c.4784 T > C p.Leu1595Pro 15 1 Profound Missense PM2_Moderate,PP3_Supporting U 0.00000401  
c.4793A > G p.Asn1598Ser 16 1 Profound Missense PM2_Strong,PP3_Supporting U NA NA  
c.4817A > G p.Asn1606Ser 16 2 Profound Missense PM2_Strong,PP3_Supporting U NA NA  
c.4898 T > C p.Ile1633Thr 17 4 Moderate to profound Missense PM2_Moderate,PP3_Supporting U 0.000111 0.00000805 Gu (2015);Rehman (2016)
c.4987G > A p.Asp1663Asn 17 1 Severe Missense PM2_Strong,PP3_Supporting U 0.0000161  
c.5036G > A p.Cys1679Tyr 18 1 Profound Missense PM2_Strong,PP3_Supporting U NA NA  
c.5134-1G > A splicing Intron 18 1 Profound Splicing PVS1_Very Strong,PM2_Moderate,PP3_Supporting P NA NA  
c.5360G > A p.Arg1787Lys 20 1 Profound Missense PVS1_Very Strong,PM2_Moderate LP NA NA  
c.5362 T > G p.Cys1788Gly 20 1 Severe Missense PVS1_Very Strong,PM2_Supporting,PP3_Supporting P NA NA  
c.5504G > T p.Arg1835Leu 21 1 Severe Missense PM2_Strong,PP3_Supporting U  
c.5507 T > C p.Leu1836Pro 21 1 Profound Missense PM2_Moderate,PP3_Supporting U NA NA  
c.5722_5725del p.Thr1908Cysfs*40 24 1 Moderately severe Frameshift PVS1_Very Strong,PM2_Moderate,PP3_Supporting P NA NA  
c.5809C > G p.Arg1937Gly 24 1 Profound Missense PM2_Moderate,PP3_Supporting U NA NA Sloan-Heggen (2016),Fattahi (2012)
c.5835 T > G p.Tyr1945Ter 24 1 Profound Nonsense PVS1_Very Strong,PM2_Moderate,PP5_Moderate,PP3_Supporting P NA NA Chang (2015)
c.5964 + 3G > A - Intron 26 3 Profound Non coding PM2_Moderate,BP4_Supporting U 0.000391 0.0000287 Gao (2013)
c.5977C > T p.Arg1993Trp 27 1 Profound Missense PM5_Moderate,PM2_Supporting,PP3_Supporting U 0.000125 0.0000321  
c.6177 + 1G > T splicing Intron 28 3 Profound Splicing PVS1_Very Strong,PM2_Moderate,PP3_Supporting,PP5_Supporting P NA NA  
c.6338 T > A p.Ile2113Asn 30 2 Profound Missense PM1_Moderate,PM2_Moderate,PM5_Moderate,PP3_Supporting LP NA NA  
c.6442 T > A p.Trp2148Arg 30 1 Profound Missense PP5_Strong,PM1_Moderate,PM2_Moderate,PP3_Supporting LP NA NA  
c.6510-1G > T splicing Intron 30 1 Profound Splicing PVS1_Very Strong,PM2_Moderate,PP3_Supporting,PP5_Supporting P NA NA  
c.6611G > A p.Arg2204His 31 1 Profound Missense PM2_Strong,PM1_Moderate,PM5_Moderate,PP3_Supporting LP NA NA  
c.6616 T > A p.Leu2206Ile 31 1 Profound Missense PM1_Moderate, PM2_Moderate, BP4_Supporting U NA NA  
c.6620C > T p.Pro2207Leu 31 1 Profound Missense PM1_Moderate, PM2_Moderate, PP3_Supporting U NA NA  
c.6634G > A p.Glu2212Lys 31 1 Profound Missense PM2_Strong, PM1_Moderate, PP3_Supporting LP 0.0000241  
c.6716A > C p.His2239Pro 31 1 Profound Missense PM2_Strong, PP3_Supporting U NA NA  
c.6764 + 1G > T splicing Intron 32 1 Profound Splicing PVS1_Very Strong, PM2_Moderate, PP3_Supporting P NA NA  
c.6956 + 9C > G - 33 2 Profound Non coding PM2_Moderate, BP4_Supporting U 0.0000706 0.00000535 Yang (2013)
c.7396-1G > A splicing Intron 37 2 Profound Splicing PVS1_Very Strong, PP5_Very Strong, PM2_Moderate, PP3_Supporting P 0.000192 0.0000141  
c.7519delC p.Pro2508Leufs*35 39 1 Moderate Frameshift PVS1_Very Strong, PM2_Moderate LP NA NA  
c.7698_7699delTG p.Glu2567Alafs*25 40 1 Severe Frameshift PVS1_Very Strong, PM2_Moderate, PP3_Supporting P NA NA  
c.7770delC p.Arg2591Glyfs*14 40 2 Profound Frameshift PVS1_Very Strong, PM2_Moderate LP NA NA  
c.8129insT p.Asp2711fs*1 43 1 Severe Nonsense PVS1_Very Strong, PM2_Moderate, PP3_Supporting P NA NA  
c.8151delC p.Leu2718Cysfs*20 45 1 Profound Frameshift PVS1_Very Strong, PM2_Moderate LP NA NA  
c.8240_8241delAC p.Gln2749Glufs*93 45 1 Profound Frameshift PVS1_Very Strong, PM2_Moderate, PP3_Supporting P NA NA  
c.8283_8306delGGTCAGCACTGCACGAGACACCTG p.2761_2769del 45 1 Profound In frame PM2_Moderate, PM4_Moderate, PP3_Supporting U NA NA  
c.8324G > T p. Arg2775Leu 46 2 Profound Missense PM2_Strong, PP3_Supporting U NA NA  
c.8324G > A p. Arg2775His 46 1 Profound Missense PM2_Strong, PP3_Supporting U 0.0000557 0.00000804 Yang (2013);Sloan-Heggen (2016)
c.8340G > A p.Thr2780Thr 46 2 Profound Synonymous PVS1_Very Strong, PM2_Moderate, PP5_Supporting P 0.00000803 Danial-Farran (2018)
c.8362C > T p.Gln2788Ter 46 1 Profound Nonsense PVS1_Very Strong, PM2_Moderate, PP3_Supporting P NA NA  
c.8458A > C p.Ser2820Arg 46 2 Profound Missense PVS1_Very Strong, PM2_Moderate, PP3_Supporting P NA NA  
c.8459G > C p.Ser2820Thr 47 1 Profound Missense PVS1_Very Strong, PM2_Moderate LP NA NA  
c.8713 + 1delGTCA splicing Intron 49 1 Severe Splicing PVS1_Very Strong, PM2_Moderate, PP3_Supporting P NA NA  
c.8745_8747delGGT p.2915_2916del 50 1 Profound In frame PM2_Moderate, PM4_Moderate, PP3_Supporting U NA NA  
c.8791delT p.Trp2931Glyfs*103 51 1 Profound Frameshift PVS1_Very Strong, PM2_Moderate, PP3_Supporting P NA NA  
c.8827insT p.Ser2945Phefs*55 51 3 Profound Frameshift PVS1_Very Strong, PM2_Moderate, PP3_Supporting P 0.000113 0.00000837  
c.8828 T > C p.Phe2943Ser 51 1 Profound Missense PM2_Moderate, PP3_Supporting U NA NA  
c.8976insA p.Val2993Serfs*7 52 1 Profound Frameshift PVS1_Very Strong, PM2_Moderate LP NA NA  
c.9358C > T p.Gln3120Ter 56 2 Severe to profound Nonsense PVS1_Very Strong, PM2_Moderate, PP3_Supporting P 0.0000556 0.00000402  
c.9400C > T p.Arg3134Ter 57 1 Severe Nonsense PVS1_Very Strong, PM2_Moderate, PP5_Moderate, PP3_Supporting P 0.00000401  
c.9401G > C p.Arg3134Pro 57 1 Profound Missense PM2_Moderate, PP3_Supporting U NA NA  
c.9478C > T p.Leu3160Phe 57 2 Moderate to severe Missense PP3_Supporting, BS2_Strong U 0.00289 0.00691 Nal (2007),Miyagawa (2013)
c.9532 T > C p.Cys3178Arg 58 2 Profound Missense PM2_Moderate, PP3_Supporting U NA NA  
c.9534C > A p.Cys3178Ter 58 1 Profound Nonsense PVS1_Very Strong, PM2_Moderate, PP3_Supporting P NA NA  
c.9690 + 1G > A splicing Intron 59 3 Profound Splicing PVS1_Very Strong, PP5_Strong, PM2_Moderate, PP3_Supporting P NA NA Chen (2015)
c.9787 + 1G > A splicing Intron 60 1 Profound Splicing PVS1_Very Strong, PM2_Moderate, PP3_Supporting P NA NA  
c.9941delA p.Tyr3314Serfs*9 61 1 Profound Frameshift PVS1_Very Strong, PM2_Moderate, PP3_Supporting P NA NA  
c.9942_9943delCAinsTGTGTG p.Tyr3314Ter 61 1 Profound Nonsense PVS1_Very Strong, PM2_Moderate, PP3_Supporting P NA NA  
c.10129dup p.Ala3377Glyfs*75 63 1 Moderately severe Frameshift PVS1_Very Strong, PM2_Moderate LP NA NA  
c.10177C > T p.Gln3393Ter 63 1 Severe Nonsense PVS1_Very Strong, PM2_Moderate, PP3_Supporting P NA NA  
c.10183C > T p.Leu3395Phe 63 1 Profound Missense PM2_Supporting, PP3_Supporting U NA NA  
c.10245_10247delCTC p.3415_3416del 64 12 Profound Frameshift PM2_Moderate, PM4_Moderate, PP3_Supporting, PP5_Supporting LP 0.000389 0.0000281 Chang (2018), Miyagawa (2015)
c.10250_10252del p.Ser3417del 64 2 Profound Frameshift PM2_Moderate, PM4_Moderate, PP3_Supporting, PP5_Supporting LP 0.000389 0.0000281  
c.10251_10253delCTT p.3417_3418del 64 7 Severe to profound In frame PM2_Moderate, PP3_Supporting U 0.000111 0.000016 Yang (2013)
c.10291_10305delGCCCCTTGCATCCTT p.3431_3435delAlaProCysIleLeu 64 1 Profound In frame PM2_Moderate, PM4_Moderate, PP3_Supporting U NA NA  
c.10350 + 2 T > G splicing Intron 64 1 Profound Splicing PVS1_Very Strong, PM2_Moderate, PP3_Supporting P 0.0000556 0.00000401  
c.10419_10423delCAGCT p.Ser3474Profs*42 65 11 Profound Frameshift PVS1_Very Strong, PM2_Moderate, PP3_Supporting P NA NA  
  1. aP pathogenic, LP likely pathogenic, U uncertain significance