Skip to main content

Table 2 Summary of the genotype–phenotype of patients in the MYO15A identified in this study

From: Analysis of the genotype–phenotype correlation of MYO15A variants in Chinese non-syndromic hearing loss patients

Patient Number Sexa Ethnicity Age of visiting(yo) Age of Onset(yo) Variant 1 Variant 2 Variant type Variant Classificationb Truncatingc Degree of HL Audiogram Configuration
M3 F Han 7 0 c.4777G > A(p.Glu1593Lys) c.8745_8747delGGT(p.2915_2916del) Compound heterozygous P/U 0/1 Profound Down-sloping
M23 M Han 2 0 c.5504G > T(p.Arg1835Leu) c.10251_10253delCTT(p.3417_3418del) Compound heterozygous U/U 0/1 Severe Flat
M73 F Han 1 0 c.8713 + 1delGTCA(splicing) c.9400C > T(p.Arg3134Ter) Compound heterozygous P/P 1/0 Severe Undefined
M80 M Han 44 41 c.2957delC(p.Thr986Ter) c.9478C > T(p.Leu3160Phe) Compound heterozygous LP/U 1/0 L:Severe; R:Moderate Undefined
M113 M Han 26 0 c.8459G > C(p.Ser2820Thr) c.10245_10247delCTC(p.3415_3416del) Compound heterozygous LP/LP 0/1 Profound Total deafness
M207 M Han 3 0 c.10245_10247delCTC(p.3415_3416del) c.10251_10253delCTT(p.3417_3418del) Compound heterozygous LP/U 1/1 Profound Down-sloping
M247 F Han 25 0 c.5977C > T(p.Arg1993Trp) c.10245_10247delCTC(p.3415_3416del) Compound heterozygous U/LP 0/1 Profound Down-sloping
M251 F Han 1 0 c.5964 + 3G > A c.8828 T > C(p.Phe2943Ser) Compound heterozygous U/U 1/0 Profound Total deafness
M291 M Han 12 0 c.3926A > T(p.Gln1309Leu) c.8827insT(p.Ser2945Phefs*55) Compound heterozygous U/P 0/1 Profound Total deafness
M294 M Han 27 0 c.8791delT(p.Trp2931Glyfs*103) c.10245_10247delCTC(p.3415_3416del) Compound heterozygous P/LP 1/1 Profound Total deafness
M337 M Han 7 0 c.5362 T > G(p.Cys1788Gly) c.8129insT(p.Asp2711fs*1) Compound heterozygous P/P 0/1 Severe Flat
M373 F Han 3 0 c.8976insA(p.Val2993Serfs*7) c.9942_9943delCAinsTGTGTG(p.Tyr3314Ter) Compound heterozygous LP/P 1/1 Profound Total deafness
M445 F Han 2 0 c.10251_10253delCTT(p.3417_3418del) c.10419_10423delCAGCT(p.Ser3474Profs*42) Compound heterozygous U/P 1/1 Profound Undefined
M448 M Han 27 0 c.7396-1G > A(splicing) c.8827insT(p.Ser2945Phefs*55) Compound heterozygous P/P 1/1 Profound Total deafness
M448-5 M Han 30 0 c.7396-1G > A(splicing) c.8827insT(p.Ser2945Phefs*55) Compound heterozygous P/P 1/1 Profound Total deafness
M488 F Han 0 0 c.8340G > A(p.Thr2780Thr) c.9532 T > C(p.Cys3178Arg) Compound heterozygous P/U 1/0 Profound Total deafness
M488-1 M Han 31 0 c.8340G > A(p.Thr2780Thr) c.8340G > A(p.Thr2780Thr) Homozygous P/P 1/1 Profound Total deafness
M488-2 F Han 33 1 c.3971C > A(p.Ala1324Asp) c.9532 T > C(p.Cys3178Arg) Compound heterozygous LP/U 0/0 Profound Total deafness
M492 F Han 3 0 c.5964 + 3G > A c.6764 + 1G > T(splicing) Compound heterozygous U/P 1/1 Profound Total deafness
M494 F Han 5 0 c.9358C > T(p.Gln3120Ter) c.10419_10423delCAGCT(p.Ser3474Profs*42) Compound heterozygous P/P 1/1 Profound Total deafness
M544 F Han 21 0 c.6177 + 1G > T(splicing) c.8458A > C(p.Ser2820Arg) Compound heterozygous P/P 1/0 Profound Total deafness
M544-3 F Han 24 0 c.6177 + 1G > T(splicing) c.8458A > C(p.Ser2820Arg) Compound heterozygous P/P 1/0 Profound Total deafness
M613 F Han 15 0 c.3118delC(p.Lys1042Argfs*16) c.10245_10247delCTC(p.3415_3416del) Compound heterozygous LP/LP 1/1 Profound Undefined
M623 M Han 6 3 c.10251_10253delCTT(p.3417_3418del) c.10251_10253delCTT(p.3417_3418del) Homozygous U/U 1/1 Severe Total deafness
M623-3 M Han 8 3 c.10251_10253delCTT(p.3417_3418del) c.10251_10253delCTT(p.3417_3418del) Homozygous U/U 1/1 Profound Total deafness
M627 M Han 3 0 c.5507 T > C(p.Leu1836Pro) c.5835 T > G(p.Tyr1945Ter) Compound heterozygous U/P 0/1 Profound Total deafness
M646 M Han 7 4 c.1179insC(p.Glu396Argfs*36) c.1261C > T(p.Pro421Ser) Compound heterozygous P/U 1/0 L:Profound; R:Mild Undefined
M653 F Han 5 0 c.8283_8306delGGTCAGCACTGCACGAGACACCTG(p.2761_2769del) c.10245_10247delCTC(p.3415_3416del) Compound heterozygous U/LP 1/1 Profound Total deafness
M656 M Han 6 0 c.6956 + 9C > G c.10419_10423delCAGCT(p.Ser3474Profs*42) Compound heterozygous U/P 1/1 Profound Total deafness
M659 M Han 6 0 c.6177 + 1G > T(splicing) c.9690 + 1G > A(splicing) Compound heterozygous P/P 1/1 Profound Total deafness
M678 F Tujia 1 0 c.8324G > T(p.Arg2775Leu) c.10419_10423delCAGCT(p.Ser3474Profs*42) Compound heterozygous U/P 0/1 Profound Total deafness
M722 M Han 2 0 c.6716A > C(p.His2239Pro) c.9787 + 1G > A(splicing) Compound heterozygous U/P 0/1 Profound Total deafness
M766 M Han 4 0 c.6620C > T(p.Pro2207Leu) c.10245_10247delCTC(p.3415_3416del) Compound heterozygous U/LP 0/1 Profound Total deafness
Y770 M Han 5 1 c.10250_10252delGCT(p.3417delSer) c.10419_10423delCAGCT(p.Ser3474Profs*42) Compound heterozygous LP/P 1/1 Profound Total deafness
M771 F Han 8 0 c.3524dupA(p.Ser1176Valfs*13) c.4441 T > C(p.Ser1481Pro) Compound heterozygous P/P 1/0 Profound Total deafness
M817 M Han 26 0 c.4519C > T(p.Arg1507Ter) c.5964 + 3G > A Compound heterozygous P/U 1/0 Profound Total deafness
Y840 F Han 22 0 c.4898 T > C (p.Ile1633Thr) c.6338 T > A (p.Ile2113Asn) Compound heterozygous U/LP 0/0 Profound Total deafness
Y840-3 M Han 20 0 c.4898 T > C (p.Ile1633Thr) c.6338 T > A (p.Ile2113Asn) Compound heterozygous U/LP 0/0 Profound Total deafness
M880 M Han 11 0 c.10245_10247delCTC(p.3415_3416del) c.10245_10247delCTC(p.3415_3416del) Homozygous LP/LP 1/1 Profound Flat
Y885 F Han 8 0 c.4777G > A(p.Glu1593Lys) c.5809C > G (p.Arg1937Gly) Compound heterozygous P/U 0/0 Profound Total deafness
Y914 M Han 7 1 c.4784 T > C (p.Leu1595Pro) c.6956 + 9C > G Compound heterozygous U/U 0/1 Profound Total deafness
M930 M Han 8 0 c.3866 + 1G > A(splicing) c.8240_8241delAC(p.Gln2749Glufs*93) Compound heterozygous P/P 1/1 Profound Total deafness
M1039 M Han 3 0 c.4037A > G(p.Lys1346Arg) c.10419_10423delCAGCT(p.Ser3474Profs*42) Compound heterozygous U/P 0/1 Profound Total deafness
M1058 F Han 2 0 c.3866 + 1G > A(splicing) c.3971C > A(p.Ala1324Asp) Compound heterozygous P/LP 1/0 Profound Total deafness
M1125 F Han 3 0 c.8362C > T(p.Gln2788Ter) c.10251_10253delCTT(p.3417_3418del) Compound heterozygous P/U 1/1 Profound Total deafness
M1197 M Han 6 0 c.9534C > A(p.Cys3178Ter) c.10245_10247delCTC(p.3415_3416del) Compound heterozygous P/LP 1/1 Profound Total deafness
M1207 M Han 6 0 c.735C > G(p.Tyr245Ter) c.10419_10423delCAGCT(p.Ser3474Profs*42) Compound heterozygous P/P 1/1 Profound Total deafness
M1247 M Han 30 0 c.4322G > T(p.Glu1441Val) c.10251_10253delCTT(p.3417_3418del) Compound heterozygous P/U 0/1 Severe Undefined
      c.1651G > A(p.Ala551Thr)   Compound heterozygous U/U 0/1   
M1324 F Han 36 0 c.9401G > C(p.Arg3134Pro) c.10245_10247delCTC(p.3415_3416del) Compound heterozygous U/LP 0/1 Profound Undefined
Y1457 F Han 5 0 c.1201delT(p.Tyr401Thrfs*43) c.5722_5725delA(p.Thr1908Cysfs*40) Compound heterozygous LP/P 1/1 Moderately severe Down-sloping
YL1467 M Han 10 4 c.3602G > A(p.Arg1201Gln) c.4567C > A(p.Leu1523Met) Compound heterozygous U/U 0/0 Moderately severe Down-sloping
M1550 M Han 6 0 c.596C > G(p.Ser199Ter) c.10177C > T(p.Gln3393Ter) Compound heterozygous P/P 1/1 Severe Down-sloping
      c.3354G > T(p.Met1118Ile)   Compound heterozygous U/P 0/1   
M1584 M Han 8 0 c.10245_10247delCTC(p.3415_3416del) c.10251_10253delCTT(p.3417_3418del) Compound heterozygous LP/U 1/1 Profound Total deafness
M1586 F Han 2 0 c.198_199delCC(p.Gln68Glufs*158) c.7698_7699delTG(p.Glu2567Alafs*25) Compound heterozygous LP/P 1/1 Severe Undefined
M1611 F Korean 28 8 c.3602G > A(p.Arg1201Gln) c.10350 + 2 T > G(splicing) Compound heterozygous LP/P 0/1 Profound Undefined
      c.900delT(p.Pro301Argfs*142)   Compound heterozygous LP/P 1/1   
M1671 F Han 5 0 c.10245_10247delCTC(p.3415_3416del) c.10419_10423delCAGCT(p.Ser3474Profs*42) Compound heterozygous LP/P 1/1 Profound Total deafness
YL1728 M Han 3 0 c.1101del(p.Tyr368Thrfs*76) c.10129dup(p.Ala3377Glyfs*75) Compound heterozygous LP/LP 1/1 Moderately severe Down-sloping
M1802 M Han 28 2 c.4898 T > C (p.Ile1633Thr) c.10419_10423delCAGCT(p.Ser3474Profs*42) Compound heterozygous U/P 0/1 Profound Undefined
M1878 M Han 7 0 c.4817A > G(p.Asn1606Ser) c.7770delC(p.Arg2591Glyfs*14) Compound heterozygous U/LP 0/1 Profound Total deafness
M1878-2 F Han 32 0 c.4817A > G(p.Asn1606Ser) c.6616 T > A(p.Leu2206Ile) Compound heterozygous U/U 0/0 Profound Undefined
M1879 M Han 2 0 c.6634G > A(p.Glu2212Lys) c.10419_10423delCAGCT(p.Ser3474Profs*42) Compound heterozygous LP/P 0/1 Profound Total deafness
M1928 M Han 13 10 c.4198G > A(p.Val1400Met) c.4430G > A (p.Arg1477His) Compound heterozygous P/U 0/0 Moderately severe Down-sloping
M1959 F Han 10 2 c.6442 T > A(p.Trp2148Arg) c.10183C > T (p.Leu3395Phe) Compound heterozygous LP/U 0/0 Profound Total deafness
M1960 F Han 5 0 c.4252G > A(p.Gly1418Arg) c.4441 T > C(p.Ser1481Pro) Compound heterozygous LP/U 0/0 Profound Total deafness
M1997 F Han 8 7 c.4898 T > C (p.Ile1633Thr) c.7519delC(p.Pro2508Leufs*35) Compound heterozygous U/LP 0/1 Moderate Down-sloping
M2018 F Han 8 0 c.1179insC(p.Glu396Argfs*36) c.10419_10423delCAGCT(p.Ser3474Profs*42) Compound heterozygous P/P 1/1 Profound Undefined
M2027 F Han 5 0 c.4441 T > C(p.Ser1481Pro) c.4642G > A(p.Ala1548Thr) Compound heterozygous U/U 0/0 Profound Total deafness
Y2082 F Han 3 1 c.3700C > T(p.Gln1234Ter) c.5036G > A(p.Cys1679Tyr) Compound heterozygous P/U 0/0 Profound Total deafness
Y2084 M Han 6 5 c.4676 T > C(p.Leu1559Ser) c.9690 + 1G > A(splicing) Compound heterozygous U/P 0/1 Profound Down-sloping
Y2103 F Han 2 0 c.4987G > A(p.Asp1663Asn) c.9358C > T(p.Gln3120Ter) Compound heterozygous U/P 0/1 Severe Flat
Y2107 F Han 6 0 c.8324G > T(p.Arg2775Leu) c.9941del(p.Tyr3314Serfs*9) Compound heterozygous P/P 0/1 Profound Total deafness
Y2109 F Han 4 0 c.2231C > A(p.Ser744Ter) c.9690 + 1G > A(splicing) Compound heterozygous P/P 1/1 Profound Total deafness
Y2110 M Han 8 0 c.3524dupA(p.Ser1176Valfs*13) c.6611G > A(p.Arg2204His) Compound heterozygous P/LP 1/0 Profound Total deafness
M2112 M Han 4 0 c.3829C > T(p.Gln1277Ter) c.5134-1G > A(splicing) Compound heterozygous P/P 1/1 Profound Total deafness
M2177 F Manchu 8 0 c.8151delC(p.Leu2718Cysfs*20) c.10291_10305delGCCCCTTGCATCCTT(p.3431_3435delAPCIL) Compound heterozygous LP/U 1/1 Profound Total deafness
M2194 M Han 21 0 c.5360G > A(p.Arg1787Lys) c.6510-1G > T(splicing) Compound heterozygous LP/P 0/1 Profound Total deafness
M2218 M Han 4 3 c.3524dupA(p.Ser1176Valfs*13) c.10250_10252del(p.Ser3417del) Compound heterozygous P/LP 1/1 Moderate Undefined
Y2123 M Han 3 0 c.4596 + 1G > A(splicing) c.4793A > G(p.Asn1598Ser) Compound heterozygous P/U 1/0 Profound Total deafness
Y2128 M Han 2 0 c.220_221del(p.Arg74Glufs*153) c.9478C > T(p.Leu3160Phe) Compound heterozygous P/U 1/0 Severe Flat
Y2129 F Han 31 1 c.4310A > G(p.Tyr1437Cys) c.8324G > A(p.Arg2775His) Compound heterozygous LP/U 0/0 Profound Undefined
Y2138 M Han 2 0 c.3136delC(p.Lys1048Argfs*10) c.4441 T > C(p.Ser1481Pro) Compound heterozygous LP/U 1/0 Severe Flat
  1. aM: Male, F: Female
  2. bP pathogenic, LP likely pathogenic, U unknown significance
  3. c1 truncating variant, 0 non-truncating variant