Skip to main content

Table 2 Primer sequence list for the three circRNAs for qPCR

From: Expression profile of circRNA in peripheral blood mononuclear cells of patients with rheumatoid arthritis

Gene Primer sequence Annealing temp (°C) Product size (bp)
GAPDH(HUMAN) F:5′GGGAAACTGTGGCGTGAT3′
R:5′GAGTGGGTGTCGCTGTTGA3′
60 299
hsa_circRNA_009012 F:5′CCTAGAAGCCACCCAAACTG3′
R:5′CAGGACTTCAGGAAAGCACC3′
60 60
hsa_circRNA_101328 F:5′GGACGGCGTCACCAACCTA3′
R:5′GCACGCATTCTTTCTGGACAT3′
60 150
hsa_circRNA_058230 F:5′TGGATGGGGAGCCCTACAAG3′
R:5′CCAGGTGCGGGTGTACAGG3′
60 94