Skip to main content

Table 1 Sequences of the primers used to validate the variant by Sanger sequencing

From: Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies in a consanguineous Iranian family is associated with a homozygous start loss variant in the PRUNE1 gene

Gene Variant Primers
PRUNE1 NM_021222.3:c.3G>A
p.(Met1?) 		Forward 5'ATTCGTCGGGGAAACCTCT 3'
Reverse 5'CTAAACTGGCTTCTCGCTCCT 3'
Back to article page

BMC Medical Genomics

ISSN: 1755-8794

Contact us