Skip to main content

Table 2 Primers used for sequencing the coding regions of the NR1H4 gene

From: Identification of two novel pathogenic variants of the NR1H4 gene in intrahepatic cholestasis of pregnancy patients

Exon Amplicon (bp) Forward primer (5′–3′) Reverse primer (5′–3′)
1 418 TGAACAGAAACCCACCCT ATCTCCAACCAAAGTCCC
2 523 ACTCCTAACCATTACGCCAAAC GCAATTAGTTCAAGGGATTTCA
3 609 TAGTGCTCACTGGCATAG GTGGTTCATTACCCTTTT
4 553 CTCAAACCTTGGCCTTCC TTTCTGCTGGCAAACACT
5 415 TCCTGCTGTATTTATGCC ATCAAGATAGGTGGGAGA
6 487 TGAAGTCTCCCACCTATC GAACAGACCTGCCTTTCT
7 465 AATGGCAATGATGGTGAT GTCTTCCTTTGGCTCTTC
8 580 GATTCACTAAATCCCATCT GCAGAATTATAGGCTACT
9 749 GGCAGAAGCTAGTTGTTA CTTGAGTGAAACTGGGTA