Skip to main content

Table 1 The sequence of specific primers for studying six candidate promoter regions of VitD R, Claudin 2, CaSR for high‐resolution melting analysis

From: The correlation between promoter hypermethylation of VDR, CLDN, and CasR genes and recurrent stone formation

Gene Locus Primers (Forward and Reverse) Length of Amplicon Tann (degrees Celsius) Number of covered CpG dinucleotides within the amplicon
CLDN14 a F: AGTTTATAGAGGTAATTTTATTTTG
R: CTACACACCAACTCATAACC
272 bp 50 18 CpG sites
CLDN14 b F: GGTTATGAGTTGGTGTGTAGT
R: TATTTAAATCACACTTAAAAT
214 bp 52 5 CpG Sites
CaSR a F: GTGTTAGGGGTTAGGGATAAGGATA
R: TCATTCTACAAAACTCAAATCAAAC
218 bp 59 11 CpG Sites
CaSR b F: AGAATGAGTAAGAGTTTGGGTA
R: CTCTTCCCTAACCCCTACTCCT
175 bp 55 8 CpG Sites
VitD R a F: TAATAGTATTAGTGGGAGTGGGGAT
R: AAATCCTAAAATAAACAAACACACC
215 56 5 CpG Sites
VitD R b F: AGTTTGGGGATAGGGGTGAGGTTA
R: CACTTATTCACCTCCACACACCTAC
168 55 11 CpG Sites