Skip to main content

Table 1 Primers used in reverse transcription-quantitative real-time PCR

From: Effects and associated transcriptomic landscape changes of methamphetamine on immune cells

Gene Primer sequence
5′–3′ Forward 5′–3′ Reverse
MVD ACCTTCCCGCCCATCTCTTA AACTCAGCCACAGTGTCGTC
HMGCS1 GGCACCAGATGTCTTCGCT CTTTCTTGGCAGGGCTTGGA
FADS2 CTGCTGATTGGTGAACTGGC ACAGGTTCATGTCCTCAGCC
LSS ACTGGACGGGTGATTATGGTG TGCACTGACCGCAGGTA
DHCR24 TCTTCCGCTACCTCTTTGGC ATGAACGGACACAGCCAGAT
S1PR2 CTCTCGGCCTCTGTCTTCAG TCACCACGCACAGCACATAA
CCL1 CTCCATCTGCTCCAATGAGGG GGAATGGTGTAGGGCTGGTA
FCER1G CTCCAGCCCAAGATGATTCCA TCGACAGTAGAGGAGGGTGAG
PLCB4 GAAAACGCCCCAGTCTTCCT AACACATCTGCAACCAGCCA
PLD1 CCTCCAATACCGGGTCCATC GGCGTGGAGTACCTGTCAAT
GAPDH AGGTCGGTGTGAACGGATTTG GGGGTCGTTGATGGCAACA