Skip to main content

Table 2 Primer Sequences and Conditions for qRT-PCR, Bisulfite sequencing and MSP Analysis

From: Promoter methylation correlates with reduced NDRG2expression in advanced colon tumour

Gene symbol RefSeq mRNA Primer Forward (5'-->3') Primer Reverse (5'-->3') Size (bp) AT (°C)
   Quantitative Real Time PCR (qPCR) assay    
ABCA8 NM_007168 CCATCATGGTATCTGGGAGGTT GCAGGTAATCTTTGCCAAATTTG 77 60
AQP8 AB013456 CACGGGCTGGCTTTGG CCAGTACGGGAGGAGCATCA 128 60
CLCA4 NM_012128 CAAAATGGCCTATCTCAGTATTCCA TCGCTTTGGCTTGAAGATTGT 68 60
HPGD1 NM_000860 GCATGGCATAGTTGGATTCACA AAGCCTGGACAAATGGCATT 83 60
PRDX6 NM_004905 GCCCTTTCAATAGACAGTGTTGAG ATCGATGATGGGAAAAGGTAACTT 104 60
SLC26A3 NM_000111 ATCGTTGGAACTGATGATGACTTC CAGCATCATGGATTGTTAAGAAAAA 90 60
STX12 NM_177424 AAGAAAGAGAAACGGCAATTCG TCATGGCCAAATCTTTAAATATCTGA 75 60
CSE1L NM_001316 CGGTTCAAACACAATAGCAAGTG GGATGCAATCAGCTTCTGAAAGA 78 60
HSPH1 NM_00664 AACAAAATCCCAGATGCTGACA ACCTTTATTTTGGGCTTTTTAGCTT 79 60
NEBL1 HSY1624 ATCCATGAGATCAATGCAGCAT CATCCTGGGCACTGTAATCGT 73 60
RFC3 NM_002915 CTGAGGGAGACTGCAAATGCT ACAGCCTTCCACGAACTTCAA 72 60
SLC12A2 NM_001046 AAGGAACATTCAAGCACAGCTAATATT TGCCATGTAGAGAGCACTAGACACA 86 60
SOX9 NM_000346 ACGCCGAGCTCAGCAAGA CACGAAGGGCCGCTTCT 70 60
GTF2IRD1 ENST00000265755 AATCTGCAATGATGCCAAGGT CCGAGACCCGCTTTCTCTT 70 60
MXI1 NM_005962 CGGCACACAACACTTGGTTT GGCTTTTTCTTTCAGCTTCTTCA 75 60
NR3C2 NM_000901 TTCATTCTCAGTACCAATAAAGCAAGA GGTTTACTGTTGGATTCCCTTTAAAA 82 60
SGK1 NM_005627 AGGAGCCTGAGCTTATGAATGC GACGACGGGCCAAGGTT 75 60
NDRG2 NM_201535 CTGACCGAGGCCTTCAAGTACT GGCGAGTCATGCAGGATGA 66 60
TPX2 NM_012112 AGCCCTTTGTTCCCAAGAAAG CCAGCTGAAAAGGTTCCTGAA 80 60
UBE2C NM_181799 TGGAGCTTACTCTGCAACTGTTTC CCAAATGCCAGAACCCAACATTGATAGTCC 74 60
CCNB1 NM_031966 CCTGGCTAAGAATGTAGTCATGGTAA GCATGCTTCGATGTGGCATA 83 60
SCNN1B ENST00000343070 CATTGAAGAATCAGCAGCCAATA CCCATCCAGAAGCCAAACTG 74 60
FOXM1 U74613 AGCAAGCGAGTCCGCATT CTGCAGAAGAAAGAGGAGCTATCC 68 60
SGK2 NM_016276 ACATCATTTACAGGGATCTGAAACC TCCTTGCAGAGGCCAAAATC 87 60
   Bisulfite Sequencing Analysis (BSA)    
NDRG2   TTTTCGAGGGGTATAAGGAGAGTTTATTTT CCAAAAACTCTAACTCCTAAATAAACA 320 53
CSE1L   GTTTGGAATTTTAGTATTTTGGGAG CTCTAACCATACCAACAAACTTCAC 285 60
HSP1   GGAGAGGGTTTGGGTATGTAA CAAAAAAATAAAATAAACCTAAAAAAC 194 56
PRDX6   TATTTTTTTGTAGGGAGTTGGT TAACATCCTTCAAACACTATAAACC 279 56
SOX9   TTTTTATTGATTTTTTTTGTAAAAG ATACCAAAATTTTAATACCTTCTCC 388 53
   Methylation-Specific PCR (MSP) assay ?    
NDRG2_UnM   AGAGGTATTAGGATTTTGGGTATGA CCACTAAAAAAACAAAAATCTCACC 125 55
NDRG2_M   AGAGGTATTAGGATTTTGGGTACG GCTAAAAAAACGAAAATCTCGC 123 55
NDRG2_UnM_2   GGTAAATTTATTTGGGTATTGA CAAAAACAAAATTAACCCTACAAA 210 54
NDRG2_M_2   TAGTGGTAAATTTATTCGGGTATCG CAAAAACGAAATTAACCCTACGA 214 62
p16-UnM   TTATTAGAGGGTGGGGTGGATTGT CAACCCCAAACCCACAACCATAA 151 65
p16-M   TTATTAGAGGGTGGGGCGGATCGC GACCCCCGAACCGCGAACCGTAA 150 68
APC-UnM   GTGTTTTATTGTGGAGTGTGGGTT CCAATCAACAAACTCCCAACAA 108 63
APC-M   TATTGCGGAGTGCGGGTC ACCACCTCATCATAACTACCCACA 98 63
MLH1-UnM   TTTTGATGTAGATGTTTTATTAGGTTGT ACCACCTCATCATAACTACCCACA 124 60
MLH1-M   ACGTAGACGTTTTATTAGGGTCGC CCTCATCGTAACTACCCGCG 115 60
  1. ?UnM = unmethylated sequence; M = methylated sequence.
  2. † AT = annealing temperature.