Skip to main content

Table 1 Primers used for real-time quantitative PCR

From: Digital karyotyping reveals probable target genes at 7q21.3 locus in hepatocellular carcinoma

Genes Primers Product Size
LINE-1 F: AAAGCCGCTCAACTACATGG
R: TGCTTTGAATGCGTCCCAGAG
149 bp
SGCE F: CAGAGACCTTGCTTCCCTTG
R: CGTCTTATCAGCCACTGCAA
193 bp
DYNC1IC F: ATACAGGACACCCAGGCAAG
R: ACTTCTCGGACCATGTCAGG
138 bp
SLC25A13 F: AGGCAGAGCTGGCAAAATAA
R: TCATGCCTTTTTGATGTGGA
105 bp
PEG10 F: CCAGTTGTCATCCACCACAG
R: TGCAATTTTCCACAGACCAA
219 bp