Skip to main content

Table 2 Primers used for real-time quantitative RT-PCR

From: Digital karyotyping reveals probable target genes at 7q21.3 locus in hepatocellular carcinoma

Genes Primers Product Size
GAPDH F: ATGGGTGTGAACCATGAGAAG
R: AGTTGTCATGGATGACCTTGG
106 bp
SGCE F: ATGCAAACACCAGACATCCA
R: TCTGATGTGGCAAGTTCTGC
220 bp
DYNC1IC F: TGTGGTCCCCCGTGCATCCT
R: AGGGCGGATGCCCCCTCAAT
127 bp
SLC25A13 F: TGGCTGAGGCCCAGAGGCAG
R: GCTCCAGCAACAGAACCCAGACC
106 bp
PEG10 F: TCCTGTCTTCGCAGAGGAGT
R: TTCACTTCTGTGGGGATGGA
111 bp