Skip to main content

Advertisement

Table 3 The primers for real-time quantitative PCR

From: DNA methylation study of fetus genome through a genome-wide analysis

Primer name Forward primer Reverse primer Amplicon size (bp)
ERG TCCCCGTGACATCTTCCAGT AGCCTCCGCCAGGTCTTTA 140
SH2D3C GGCTAAAGGAACTGTCAGAAAATG CGGGTTGAAGGAAGAAGTGAC 95
EML3 CTTCAACCCTCGTGACAGCA ATTCCCAGGAACCCCTACTC 94
TRIM71 CCACAGCTTCATCTACCTCCA TTCTTATGCCTCGCCGTCA 195
HOXA3 TTCCACTTCAACCGCTACCT GTACTTCATGCGGCGATTCT 111
HOXA11 GCCCAAGGTAGCCCAATAA CTGGACCCGAGACGTAGTAAGT 94
HOXA5 GCGAGCCACAAATCAAGCA GGATAGCGACCGCAAAATG 77