Skip to main content

Advertisement

Table 11 The primers used for mRNA qPCR

From: MicroRNA and mRNA expression profiling in rat acute respiratory distress syndrome

rTIMP1-up CAGCAAAAGGCCTTCGTAAAGA
rTIMP1-down GATCTGATCTGTCCACAAGCAATG
rSOD2-up GCCTGCACTGAAGTTCAATGG
rSOD2-down CCCAAAGTCACGCTTGATAGC
rTSPAN8-down GCAGTTGGGTCCATCATCATG
rTSPAN8-up GGCTACTTGCAGAAGCAGAATCA
rACAA2-down ACGTGAGTGGAGGTGCCATAG
rACAA2-up AAGCTGATCCCACTGCGTATTT
rMDH1-down CTACTGAAAGCCAACGTGAAGATC
rMDH1-up AGGCCGTCAGGCAGTTTGTAT
rRAMP2-down TCATCCTACTGAGGACAGCCTTCT
rRAMP2-up CAGTTGCACCAGTCCTTGACA