Skip to main content

Table 3 Bisulfite pyrosequencing primers

From: Epigenetic modifications and glucocorticoid sensitivity in Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS)

Targeted Gene/Site(s) Primer Direction Primer Sequence (5’ to 3’)
JRK (cg24634471 and cg10596483) Out Forward GTAGGCGGGTTGAGTATTGG
Out Reverse CGACCTAAACCCCGAACTCC
In Forward GTTTTGGTGATAGGAAGGTAGTATTGT
In Reverse [Biotin]-AACTCCCCCCTACTCTCTCCATCTATA
Sequencing GGAAGATAGTTTTGGGTTGA
SLC6A4 (cg20592995) Out Forward TTGGGGAAAGGAGGTTAAGG
Out Reverse GCTCGCTAACGATCACGATT
In Forward AAGTGATAGGTGGTTAGATGAT
In Reverse [Biotin]-CCTTTCATTTCACATAAAACCCTTAATATA
Sequencing TTTTTTATTTAAGTTTTTGAGAGT
  1. Outer and inner PCR primer sequences used for the bisulfite pyrosequencing assay