Skip to main content

Table 2 Sequence of primers and Taqman probes

From: Interrelation of chemerin and TNF-α with mtDNA copy number in adipose tissues and blood cells in obese patients with and without type 2 diabetes

Gene Primer (5′-3′) Product length
Mitochondrial gene ND1
 ND1_f ccctaaaacccgccacatct 65
 ND1_r gagcgatggtgagagctaaggt
 ND1_probe HEX-ccatcaccctctacatcaccgccc-BHQ1
Nuclear gene P30
 RPP30_f gatttggacctgcgagcg 62
 RPP30_r gcggctgtctccacaagt
 RPP30_probe FAM-ctgacctgaaggctct-BHQ1
 TNFA_f ccctcaacctcttctggctcaa 97
 TNFA_r ccaggtttcgaagtggtggtct
RARRES2 (Chemerin)
 RARRES2_f tgaggacccccacagcttct 92
 RARRES2_r aggcaccacgcatctcagtg
ADIPOQ (Adiponectin)
 ADIPOQ_f tccccaacatgcccattcgct 97
 ADIPOQ_r agcccaggaatgttgcagtgga
B2M (Reference gene)
 B2M_f cctgccgtgtgaaccatgtg 70
 B2M_r gctgcttacatgtctcgatccca