Skip to main content

Table 2 Primer sequences, position, product length and CpG units used for MassArray quantitative methylation analysis

From: DNA methylation status of TBX20 in patients with tetralogy of Fallot

Gene Forward primer (5′ → 3′)a Reverse primer (5′ → 3′)b Distance Product No of CpG’s Coverage
(bp)c Length (bp)   (CpG units)
TBX20_M1 TTTGAGTGTGTATGTTAGTTTGAGTTT CTCCTATTTTCCCTAAAAAAACCCT −945~ − 635 311 23 22
TBX20_M2 GTGAGATTAGGTGGGGATGTTTAT TCCTTCCTCCCTCTAAAACTAAAAA − 214~167 382 42 32
  1. a10-mer tag: cagtaatacgactcactatagggagaagg
  2. bT7 promoter tag: aggaagagag was added
  3. cRelative to the transcription start site