Skip to main content

Table 2 Primer sequences, position, product length and CpG units used for MassArray quantitative methylation analysis

From: DNA methylation status of TBX20 in patients with tetralogy of Fallot

Gene

Forward primer (5′ → 3′)a

Reverse primer (5′ → 3′)b

Distance

Product

No of CpG’s

Coverage

(bp)c

Length (bp)

 

(CpG units)

TBX20_M1

TTTGAGTGTGTATGTTAGTTTGAGTTT

CTCCTATTTTCCCTAAAAAAACCCT

−945~ − 635

311

23

22

TBX20_M2

GTGAGATTAGGTGGGGATGTTTAT

TCCTTCCTCCCTCTAAAACTAAAAA

− 214~167

382

42

32

  1. a10-mer tag: cagtaatacgactcactatagggagaagg
  2. bT7 promoter tag: aggaagagag was added
  3. cRelative to the transcription start site